Home
Latest kids shoes design,latest fancy shoes for little girls.Fancy shoes for little princes baby girls shoes deisgn
Views: 982790 JIN YANG
Latest Designer Fancy Shoes for Kid Girls // Cute & Stylish // Part 1
 
01:28
We always try to make our subscribers updated about latest fashion trends, living styles and much more, Take a look at this video and stay updated with FUNtastic World :) Facebook : https://www.facebook.com/FUNtastic-World-209899076083809/ Twitter : https://twitter.com/FUNtasticWorld7 https://www.pinterest.com/funtasticworld7/ Artist: Alvaro Angeloro Title: Let’s Party http://www.hooksounds.com Let's Party by HookSounds http://www.hooksounds.com/ Creative Commons — Attribution 4.0 International — CC BY 4.0 https://creativecommons.org/licenses/... -~-~~-~~~-~~-~- Please watch: "Latest & Stylish Gold Bangles Designs with Weight 2017-2018 | Girls Woman Jewelry" https://www.youtube.com/watch?v=4nmG71l0qS8 -~-~~-~~~-~~-~-
Views: 623289 FUNtastic World
kids stylish shoes | Latest Kids Long Shoes | Latest Girls Fancy Shoes
 
03:01
Latest girls fancy shoes,kids stylish shoes,kids fancy shoes,latest kids red shoes,kids stylish long shoes,latest girls long shoes,latest girls stylish shoes,little girls fancy shoes,latest kids shoes design,latest kids sandals,kids party shoes,latest girls party shoes,new kids party foot wear,beautiful shoes for little girls,cute shoes for girls,cute shoes for kids,girls beautiful shoes,awesome kids shoes design,
Views: 7696 JIN YANG
Kids Girls Shoes And Sandal Design for baby Girl Fancy Stylish Beautiful Design
 
01:29
Kids Girls Shoes And Sandal Design for baby Girl Fancy Stylish Beautiful Design
Views: 9513 Fashion Point
MINI BEAUTY ACCESSORIES TOYS FOR GIRLS WITH DISNEY PRINCESS SHOES ,WAND TIARA AND MAKEUP TOYS
 
02:35
Hello Welcome to my channel Kids Day, a channel dedicated to the entertainment of children and their parents, where you will find videos of Play Doh, drawings, colors, homemade experiments, crafts, and curiosities. We make a super cool Kids-Friendly Educational and Fun videos that will entertain the whole family. You may have more fun and learning by visiting our Other following Channel: https://www.youtube.com/dashboard?o=U
Views: 72443 kids day
Latest Kids Fancy Shoes | Latest Kids winter Shoes Design | Kids Stylish Shoes | Latest kids sandals
 
02:01
Latest kids canvas shoes design,kids canvas shoes,kids stylish canvas shoes,kids fancy shoes design,Latest kids sandals,kids fancy sandals,kids fancy sandals design,latest kids party shoes,latest kids party shoes design,kids fancy sandals,kids fancy shoes design,latest kids fancy shoes,latest kids party shoes design,latest kids party foot wear,latest kids winter shoes design,latest kids long shoes design,latest little girls shoes design,latest baby girl shoes design,latest baby girl fancy shoes design,latest baby girl sandal design,latest kids sandal design.
Views: 7028 JIN YANG
Kids & baby shoes online BD - Baby sandals, Girls-boys, school shoe, pumps,sports shoes,skater shoes
 
04:56
Welcome you all to Reporter Rupa. My channel is all about ( Market & Lifestyle vlogs) Don't forget to subscribe to my channel for interesting Videos. "Reporter Rupa" is a service-oriented channel.please Like, Share, comments and Subscribe For Business Promotion & Sponsors contact: Email:[email protected] Mobile: +8801773799240 (IMO) +8801830646430 (WhatsApp ) Also, Subscribe to my other channels: Smart Shopping Guide https://www.youtube.com/channel/UCCZeUSnSieNOyU_ncfzvnlw #ReporterRupa Follow On Facebook Page : https://www.facebook.com/ReporterRupa Follow Me On Twitter : https://twitter.com/RupaRoise Join With Us Facebook Gorup: https://www.facebook.com/groups/ReporterRupa/ Visit Our Official Website: http://www.reporterrupa.com/ baby shoes girl, baby shoes boy, baby shoes in dhaka, baby shoes online bangladesh, boy baby shoes in bd, baby shoes for boys in bangladesh, apex baby shoes, apex baby shoes bd, baby shoes in dhaka, baby girl shoes in dhaka, apex baby shoes, apex baby shoes bd, online baby shop bangladesh, baby shoes for boys in bangladesh, online shoes shopping in bangladesh,
Views: 19535 Reporter Rupa
Latest Designer Fancy Shoes for Kid Girls // Cute & Stylish // Part 2
 
01:28
We always try to make our subscribers updated about latest fashion trends, living styles and much more, Take a look at this video and stay updated with FUNtastic World :) Facebook : https://www.facebook.com/FUNtastic-World-209899076083809/ Twitter : https://twitter.com/FUNtasticWorld7 https://www.pinterest.com/funtasticworld7/ summer smile -~-~~-~~~-~~-~- Please watch: "Latest & Stylish Gold Bangles Designs with Weight 2017-2018 | Girls Woman Jewelry" https://www.youtube.com/watch?v=4nmG71l0qS8 -~-~~-~~~-~~-~-
Views: 184444 FUNtastic World
Girls High Heel Shoes, Little Girls High Heels In Child And Toddler Shoe
 
02:21
Girls High Heel Shoes, Little Girls High Heels In Child And Toddler Shoe beautiful latest collection and big demanded High Heels new collection new design new amazing future style for high heels beautiful women collection high heel shoes boots and sandal. Sub - https://goo.gl/Kdgwpy Google+ - https://goo.gl/Tmhmsc FB - https://goo.gl/PSaK6S Blog - https://goo.gl/tBWY6H Twitter - https://goo.gl/xDtdok Pinterest - https://goo.gl/VHYhre Reddit - https://goo.gl/4H65oC Tumblr - https://goo.gl/x8MPsW Like, Share & Subscribe Our Channel to Watch More Awesome Latest 2018 Fashion Collection.
Views: 19300 Girls New Fashion 2

More videos »

FAME speaks to the editor of Company Magazine Victoria White
 
03:52
FAME magazine (www.fameonline.co.uk) was invited to meet the editor of Company Magazine, Victoria White. She shares her experience(s) with us, and she tells us how to get a job in the media world.
Views: 604 FameUH
73 Questions with Anna Wintour | Vogue
 
05:45
From her least favorite word in fashion to why she always has on her Chanel shades, Vogue’s Editor in Chief shares the 73 things that make her Anna Wintour. Still haven’t subscribed to Vogue on YouTube? ►► http://bit.ly/vogueyoutubesub ABOUT VOGUE Vogue is the authority on fashion news, culture trends, beauty coverage, videos, celebrity style, and fashion week updates. 73 Questions with Anna Wintour | Vogue Created by Joe Sabia Director of Photography: Vincent Peone Production Company: Original Media
Views: 7000383 Vogue
Simon Sinek: How to Build a Company That People Want to Work For | Inc. Magazine
 
08:56
Simon Sinek, author of Start With Why, explains to Inc. features editor Diana Ransom why great leaders give their employees the space and responsibilities to grow. Click here to watch part 2 | Simon Sinek: The Common Email Mistake that Ruins Workplace Morale http://www.inc.com/simon-sinek/how-to-build-a-company-that-people-want-to-work-for.html#t=18:52 Subscribe to Inc.'s channel, click here: http://www.youtube.com/user/incmagazine?sub_confirmation=1 Get social with Inc. on: Facebook: https://www.facebook.com/Inc Twitter: https://twitter.com/Inc G+: https://plus.google.com/+incmagazine/posts Linkedin: https://www.linkedin.com/company/inc--magazine Instagram: https://www.instagram.com/incmagazine/ Pinterest: https://www.pinterest.com/incmagazine/
Views: 130932 Inc.
Entrepreneur & Editor of Fast Company Magazine Talks Business.
 
34:49
Source: https://www.podbean.com/media/share/pb-5pxdy-931c48 In this weeks Episode I speak with Evans Manyonga, ex Editor of Fast Compay Magizine South Africa, top 100 under 40 most influencial people in SA and CCO and co founder of ReignMakers. Evans speaks about growing up in Zimbabwe and his media career to Date, what keeps him motivated and his best life advice.    Chef Raymond McCardle Winner of Great British Menu on BBC and owner of the Forge Restaurent Kells gives us his Recipe for Samosas and Lentil Dahl.  Chef Hugh MCGivern Chef to the Royals gives us his recipe for Cranachan wit Toasted Coconut & Raspberries & Balinase Chicken.
Views: 8 Susan Smyth
Company Magazine 1980-2012
 
01:16
How Company Magazine's covers have developed from their launch in 1978 until 2012.
Views: 89 Hollie Wilson
📖 Getting Into Publishing & My Career So Far.
 
17:22
Today I'm chatting about how I got my first internships and jobs in publishing! Get the first 3 months of Skillshare for $0.99 👉http://skl.sh/booksandquills99 (valid until the end of January 2018) Thanks to Skillshare for sponsoring this video! It's so hard to find info about working in publishing online, so I figure I'd share my story and a bit about my day to day activities in the different jobs I've had. Everyone's story and situation is different and the application processes and jobs also change over time, but I hope it's still helpful. If you have any questions or suggestions for future videos around this theme, leave them in a comment below! Some classes to try out: Excel Zero to Hero: https://www.skillshare.com/classes/Microsoft-Excel-2016-Bootcamp-Zero-to-Hero-Training/1023805735 Writing Effective Emails for Email Marketing: https://www.skillshare.com/classes/Email-Marketing-Essentials-Writing-Effective-Emails/2044052141 Beginners Photoshop (Using the Tools Panel, Cropping etc.): https://www.skillshare.com/classes/Photoshop-CC-2015-Fundamentals-Class-1-Using-the-Tools-Panel/1448728686? Word Zero to Hero: https://www.skillshare.com/classes/Microsoft-Word-2016-Word-Bootcamp-Zero-to-Hero-Training/1233233581 // m e Check out my enamel book pin! http://bit.ly/DontCrackTheSpinePin Follow what I'm reading on GoodReads. http://www.goodreads.com/booksandquills Twitter http://www.twitter.com/booksandquills Insta http://www.instagram.com/booksandquills Blog (travel, food & London) http://booksandquills.co.uk // d e r p i n a m o d e Cruelty-free beauty and lifestyle channel with Marion. http://www.youtube.com/Derpinamode http://www.twitter.com/derpinamode http://www.instagram.com/derpinamode // c a p t i o n s Help me out by contributing captions/subtitles on my videos. Thanks so much to everyone who’s already contributed! A guide: https://support.google.com/youtube/answer/6054623?hl=en-GB // t a l k s & p a n e l s I can give talks, moderate panels or appear on panels on a variety of topics, from BookTube to working with brands, how to start a YouTube channel, building your personal brand online, productivity, and much more. I can also host author Q&As, panels and other publishing events. Get in touch at [email protected] or visit my website for more info: http://www.booksandquills.co.uk/panels-public-speaking/ // s p o n s o r s h i p s I’m available to work with brands, both on YouTube and on my other social channels (Twitter, Instagram, blog). Feel free to get in touch at [email protected] // f a q Can you review my book? I’m always happy to hear about upcoming books, but I’m afraid I don’t review self-published books and can only accept a small number of books for review. I enjoy reading classics, dystopian/apocalyptic novels, sci-fi, translated fiction and a variety of graphic novels, YA and contemporary literary fiction. Get in touch at [email protected] Where is your accent from? I was born and raised in the Netherlands, studied English Lit at Leiden University (also in the Netherlands), studied in the US for 3 months and have lots of American friends. I'm definitely not Irish or Canadian, I promise! Where do you live? I live in London and have been here for 4 years now. How did you get into publishing? I did publishing work experience, did a lot of networking and learned everything I know about social media from creating and running this channel. (P.s. You don't necessarily have to study Publishing or English to get a job in publishing!).
Views: 41435 booksandquills
Company Magazine Style - Episode 10 - Britain and Ireland's Next Top Model Cycle 7
 
03:34
Styling conversation with the editor and fashion editor of Company Magazine.
Views: 444 xTheTopModelsx
Fast Company Editor: Why Austin Selected as Fast City
 
01:54
TateAustin invited Fast Company Magazine Senior Editor Keith Hammonds to the The Human Capital for a special event to welcome Thomas Properties Group to the city. Thomas Properties and its partners are investing $1.15 billion in Austin with the acquisition of ten Class A office properties totaling approximately 3.5 million square feet. Hammonds talked with community and business leaders about why the magazine selected Austin as one of its "Fast Cities 2007." The magazine scoured the globe in search of the perfect place to transplant a business. Fast Company selected 30 urban centers that are shaping the future. Watch the video to hear Hammonds discuss why the world wants to know Austin's secret to continuously attracting creative and productive people. For information contact: Russ Rhea TateAustin Public Relations [email protected] http://www.tateaustin.com
Views: 225 russrhea
LinguaTV Interview with Ian McMaster - Chief Editor of "Business Spotlight" (at OEB17)
 
03:30
More information can be found at: https://www.linguatv.com/blog.html Ian McMaster is Editor-in-Chief of "Business Spotlight", a print magazine for Business English. In an interview with LinguaTV, he gives an overview of the latest developments in e-learning: - How can learning opportunities be made more flexible and individual? - Is the classic print magazine still up-to-date? - What will the learning of the future look like? Ian McMaster ist Chefredakteur von “Business Spotlight”, dem alle zwei Monate erscheinenden Magazin für Wirtschaftsenglisch. Im Interview mit LinguaTV gibt er einen Überblick über die neuesten Entwicklungen im Bereich E-Learning: - Wie können Lernangebote flexibler und individueller gestaltet werden? - Ist das klassische Print-Magazin noch zeitgemäß? - Wie wird das Lernen der Zukunft aussehen? Mehr Infos finden Sie unter: https://www.linguatv.com/blog.html
Views: 440 LinguaTV.com

More videos »

Can You Name a Country?
 
03:45
Donald Trump is overseas visiting Belgium, England, Scotland and then his pal Putin in Russia. It is imperative that America has strong relationships with and knowledge about other nations, and that responsibility extends to all of us. So we came up with a test and went out on the street to ask people passing by, to name any country on a map. It didn't go well. Pedestrian Question World Cup Edition – Are You Drunk? https://youtu.be/y0fU1gSvvYQ SUBSCRIBE to get the latest #KIMMEL: http://bit.ly/JKLSubscribe Watch Mean Tweets: http://bit.ly/KimmelMT10 Connect with Jimmy Kimmel Live Online: Visit the Jimmy Kimmel Live WEBSITE: http://bit.ly/JKLWebsite Like Jimmy Kimmel on FACEBOOK: http://bit.ly/KimmelFB Like Jimmy Kimmel Live on FACEBOOK: http://bit.ly/JKLFacebook Follow @JimmyKimmel on TWITTER: http://bit.ly/KimmelTW Follow Jimmy Kimmel Live on TWITTER: http://bit.ly/JKLTwitter Follow Jimmy Kimmel Live on INSTAGRAM: http://bit.ly/JKLInstagram About Jimmy Kimmel Live: Jimmy Kimmel serves as host and executive producer of Emmy-winning "Jimmy Kimmel Live," ABC's late-night talk show. "Jimmy Kimmel Live" is well known for its huge viral video successes with 5.6 billion views on YouTube alone. Some of Kimmel's most popular comedy bits include - Mean Tweets, Lie Witness News, Jimmy's Twerk Fail Prank, Unnecessary Censorship, YouTube Challenge, The Baby Bachelor, Movie: The Movie, Handsome Men's Club, Jimmy Kimmel Lie Detective and music videos like "I (Wanna) Channing All Over Your Tatum" and a Blurred Lines parody with Robin Thicke, Pharrell, Jimmy and his security guard Guillermo. Now in its sixteenth season, Kimmel's guests have included: Johnny Depp, Meryl Streep, Tom Cruise, Halle Berry, Harrison Ford, Jennifer Aniston, Will Ferrell, Katy Perry, Tom Hanks, Scarlett Johansson, Channing Tatum, George Clooney, Larry David, Charlize Theron, Mark Wahlberg, Kobe Bryant, Steve Carell, Hugh Jackman, Kristen Wiig, Jeff Bridges, Jennifer Garner, Ryan Gosling, Bryan Cranston, Jamie Foxx, Amy Poehler, Ben Affleck, Robert Downey Jr., Jake Gyllenhaal, Oprah, and unfortunately Matt Damon. Can You Name a Country? https://youtu.be/kRh1zXFKC_o
Views: 19280911 Jimmy Kimmel Live
Celebrities Read Mean Tweets #11
 
03:07
When it comes to mean tweets, no one can touch Donald Trump but that doesn’t mean there aren’t those who try. From time to time we shine a light on the trolls by asking famous people to read the not-so-nice things people write about them. We’ve done it again for our 11th edition of celebrities reading #MeanTweets featuring Gal Gadot, Emma Watson, Jake Gyllenhaal, Elisabeth Moss, John Lithgow, Dave Chappelle, Jeffrey Tambor, Gwyneth Paltrow, Jennifer Aniston, Jim Parsons, Nikolaj Coster-Waldau, Jennifer Lawrence, Kristen Bell, Bob Odenkirk, Michael Keaton, Alec Baldwin and Kumail Nanjiani. Round 3 of Jimmy Kimmel’s Health Care Battle https://youtu.be/KUH0KQ1qMiw SUBSCRIBE to get the latest #KIMMEL: http://bit.ly/JKLSubscribe Watch Mean Tweets: http://bit.ly/KimmelMT10 Connect with Jimmy Kimmel Live Online: Visit the Jimmy Kimmel Live WEBSITE: http://bit.ly/JKLWebsite Like Jimmy Kimmel on FACEBOOK: http://bit.ly/KimmelFB Like Jimmy Kimmel Live on FACEBOOK: http://bit.ly/JKLFacebook Follow @JimmyKimmel on TWITTER: http://bit.ly/KimmelTW Follow Jimmy Kimmel Live on TWITTER: http://bit.ly/JKLTwitter Follow Jimmy Kimmel Live on INSTAGRAM: http://bit.ly/JKLInstagram About Jimmy Kimmel Live: Jimmy Kimmel serves as host and executive producer of Emmy-winning "Jimmy Kimmel Live," ABC's late-night talk show. "Jimmy Kimmel Live" is well known for its huge viral video successes with 5.6 billion views on YouTube alone. Some of Kimmel's most popular comedy bits include - Mean Tweets, Lie Witness News, Jimmy's Twerk Fail Prank, Unnecessary Censorship, YouTube Challenge, The Baby Bachelor, Movie: The Movie, Handsome Men's Club, Jimmy Kimmel Lie Detective and music videos like "I (Wanna) Channing All Over Your Tatum" and a Blurred Lines parody with Robin Thicke, Pharrell, Jimmy and his security guard Guillermo. Now in its fifteenth season, Kimmel's guests have included: Johnny Depp, Meryl Streep, Tom Cruise, Halle Berry, Harrison Ford, Jennifer Aniston, Will Ferrell, Katy Perry, Tom Hanks, Scarlett Johansson, Channing Tatum, George Clooney, Larry David, Charlize Theron, Mark Wahlberg, Kobe Bryant, Steve Carell, Hugh Jackman, Kristen Wiig, Jeff Bridges, Jennifer Garner, Ryan Gosling, Bryan Cranston, Jamie Foxx, Amy Poehler, Ben Affleck, Robert Downey Jr., Jake Gyllenhaal, Oprah, and unfortunately Matt Damon. Celebrities Read Mean Tweets #11 https://youtu.be/t2oVUxTV4WA
Views: 51067088 Jimmy Kimmel Live
Child Genius: Meet Arnav, Who Never Stops Reading | Lifetime
 
01:51
Meet Arnav, the book-obsessed perfectionist who joined Mensa at age 6, in this scene from Season 2, Episode 2, "Silicon Valley is All About Taking Risks." #ChildGenius Subscribe for more from Child Genius and other great Lifetime shows: http://www.youtube.com/subscription_center?add_user=lifetime Find out more about the kids and the competition on our site: http://www.mylifetime.com/shows/child-genius?cmpid=Social_YouTube_ChildGenius Catch up on Season 1 with this playlist: https://www.youtube.com/playlist?list=PLvAOsBfvt4jDvQl4jxevE0s0TMFnUb6OI Watch full episodes here: http://www.mylifetime.com/shows/child-genius/video?cmpid=Social_YouTube_ChildGeniusVideo Check out exclusive Lifetime content: Website - http://www.mylifetime.com Twitter - https://twitter.com/lifetimetv Facebook - https://www.facebook.com/lifetime /posts Child Genius Season 2 Episode 2 Silicon Valley is All About Taking Risks "Child Genius" is a competition series centered on Americas most extraordinary and gifted children and their families as they prepare for a national intelligence competition. Lifetime® is a premier female-focused entertainment destination dedicated to providing viewers with a diverse selection of critically acclaimed and award-winning original movies, scripted dramas, and unscripted programming. A favorite and trusted network for women, we are continually building on our heritage by attracting top Hollywood talent and producing shows that are modern, sexy, exciting, daring, and provocative. Visit us at myLifetime.com for more info.
Views: 1696736 Lifetime
Stranger Things Cast Answer the Web's Most Searched Questions | WIRED
 
07:11
Stranger Things stars Gaten Matarazzo and Joe Keery take the WIRED Autocomplete Interview and answer the Internet's most searched questions about Stranger Things and themselves. Joe and Gaten answer hard-hitting questions like, "Is Gaten Matarazzo now?" and "Is Joe Keery legit?" Still haven’t subscribed to WIRED on YouTube? ►► http://wrd.cm/15fP7B7 Also, check out the free WIRED channel on Roku, Apple TV, Amazon Fire TV, and Android TV. Here you can find your favorite WIRED shows and new episodes of our latest hit series Tradecraft. ABOUT WIRED WIRED is where tomorrow is realized. Through thought-provoking stories and videos, WIRED explores the future of business, innovation, and culture. Stranger Things Cast Answer the Web's Most Searched Questions | WIRED
Views: 32360868 WIRED
Drew Barrymore & Henry Thomas Reading -  Golden Globes 1983
 
02:09
E.T. child actors Drew Barrymore and Henry Thomas read a story about "Hollywood Press-Land" and how winners are picked for the Golden Globe awards. License Golden Globe Awards Clips Here: http://dickclarklicensing.com/Default.aspx?&sk=DCMA&q=Golden+Globe+Awards
Views: 240721 AwardsShowNetwork
6 Year Old Bad Lip Reading
 
02:40
Film a 6 year old, turn the volume down, and voice over what you think he is saying... the result is a bad lip reading. Enjoy! 2 Year Old Bad Lip Reading http://youtu.be/TdP9Kb7N6OQ Last week's video: http://youtu.be/w7jY_gkcts0 Check out the pro: http://youtube.com/badlipreading Check out Cullen and Katie http://youtube.com/bamachick1101 EzE's Twitter: http://twitter.com/#!/epoddle Amy's Twitter: http://twitter.com/#!/mama2cocobean BUY SHIRTS!!! http://www.districtlines.com/epoddle music: incompetech.com
Views: 165486 epoddle
Reading People's Assumptions About Me | Sophia Grace
 
10:13
Reading People's Assumptions About Me Wow, this was really cool reading people's assumptions about me, i tried my best to react to as many of you're assumptions about me but there was so many, this was real talk and i really enjoyed reading through all the assumptions. https://www.youtube.com/channel/UCBbl9TWafqQcPfsdG32t--A?sub_confirmation=1 Watch Next, “My Go To Makeup Look" https://youtu.be/9xDd6ylPfjM Follow Sophia Grace: Facebook: https://www.facebook.com/SophiaGraceTheArtist Instagram: http//instagram.com/therealsophiagrac Twitter: http//twitter.com/princessSGB Snapchat: sophiagrace2003 Musical.ly: @sophiagrace Watch More Sophia Grace: All Of My Videos: https://www.youtube.com/watch?v=848unUmgXio&t=0s&list=PLedNpcvFJ3w7fGhdghHybIbdbKL6Ii9Pm&index=1 Collaborations: https://www.youtube.com/watch?v=W55xOPmP1vI&index=2&list=PLedNpcvFJ3w6zjE-jRjuWbTIYySShfMGS&t=85s Makeup & Beauty: https://www.youtube.com/watch?v=K9Ae3NhZqIQ&index=1&list=PLedNpcvFJ3w7NmMDvqE8UJR4b5wFDa6Vd&t=0s Vlogs: https://www.youtube.com/watch?v=Kz9EfW55qA4&index=2&list=PLedNpcvFJ3w4aGGZd9qL-fNhZLZFNJ5Y-&t=0s ABOUT SOPHIA GRACE Welcome to the official YouTube channel of the Actress, Singer, Recording Artist, Makeup Artist and Ellen Show star, Sophia Grace. If you aren’t already subscribed, you might recognize her from The Ellen show where Sophia Grace rapped Nicki Minaj’s Super Bass for a live studio audience after their YouTube video of the same performance went viral. 5 years later Sophia Grace is quickly becoming a force to be reckoned with as she makes some of the best kids music out there. From her hit singles “Best Friends,” and “Girls Just Gotta Have Fun,” "Girl In The Mirror" and "Hollywood" to her the hilarious music parodies you can find on her channel, Princess Sophia Grace is poised to grow into the ultimate pop music icon.Sophia Grace loves making Makeup Tutorials, Fun Challenges such as the Smoothie Challenge and Best Friend Challenge to Working to spread joy and inspire other little girls with her song covers, original music, and comedic acting, it’s hard not to love Sophia Grace. Please subscribe if you’re new to the channel and join in the fun!!!
Views: 1363956 Sophia Grace
Behind the Read: A Reading for a Newborn Baby | Long Island Medium
 
06:44
Nurse Jackie not only helped remove Theresa's stitches... but she also got to learn how her grandmother was really with her in Spirit... even when giving birth to her baby. | For more, visit http://tlc.howstuffworks.com/tv/long-island-medium/#mkcpgn=yttlc1 Long Island Medium games, quizzes and more! | http://www.tlc.com/tv-shows/long-island-medium/games-and-more/#mkcpgn=yttlc1 Watch full episodes! | http://www.youtube.com/user/tlcfullepisodes Subscribe to TLC! | http://www.youtube.com/subscription_center?add_user=tlc
Views: 2063345 TLC

More videos »

Special C - S/T (Full Album)
 
39:35
.
Views: 2895 John Bosco
U.S. Navy SPECIAL BOAT TEAM parachute into the sea with assault boats from C-17
 
01:37
ATLANTIC OCEAN (April 18, 2018) U.S. Navy Special Warfare Combatant-craft Crewmen (SWCC) of the Special Boat Team 20, execute the insertion of two Combatant Craft Assault vehicles using the Low Velocity Airdrop Delivery System (LVADS) at 4,000 feet, during a training exercise from a C-17 Globemaster III. The LVADS platform is pulled by the aircraft by extraction parachutes, then the recovery parachutes that are attached to the load deploy to slow the descent and allow a suitable water impact velocity.
Views: 71954 MilitaryNotes
Motu Patlu | Deep Sea Adventure | FULL MOVIE | New Years Special | Wow Kidz
 
01:14:45
Motu Patlu are on a sea voyage with Dr Jhatka, Ghaseetaram and Chingum. Their ship sank due to storm. They land in a Shark kingdom deep under sea , where they were arrested By Sharkuni the Wizard Shark. Sharkuni Give them a special suit with which they can breathe and talk under water also. Sharkuni is a very cunning and shrewd Wizard and Right hand man of King shark . He has captured King and queen of Mermaids and enslaved all Mermaids. Mermaids are being used to dig underground tunnels from one sea to other sea. Sharkuni is planning to join all seas of the world by underground tunnels so king shark can travel from one sea to other sea and rule sea creatures all over the world CLICK - SUBSCRIBE, SHARE, LIKE. #wowkidz #motupatlu Follow Wowkidz: Blog- http://wowkidztv.blogspot.in/ Facebook- https://www.facebook.com/WowKidzTV/ Instagram- https://www.instagram.com/wowkidztv/ Twitter- https://twitter.com/WowKidzTv WowKidz Channels are now streaming on YuppTV worldwide (Except India, Maldives, Bangladesh, Bhutan, Nepal, Sri Lanka). Click the links below to watch- WOW Kidz Hindi Channel:-https://www.yupptv.com/channels/wow-kidz-hindi/live WOW Kidz Tamil Channel:- https://www.yupptv.com/channels/wow-kidz-tamil/live WOW Kidz Telugu Channel:https://www.yupptv.com/channels/wow-kidz-telugu/live If you read this then comment "I am a Wow Kid" :) Subscribe to our other channels: WOWKIDZ RHYMES & SHOWS: https://goo.gl/xg7wnh WOWKIDZ COMEDY: https://goo.gl/HQtaCG WOWKIDZ ACTION :https://goo.gl/1cnYvc WOWTEENZ: https://goo.gl/jAsQ3m WOWKIDZ FIRANGI: https://goo.gl/zKw3a1 WOWKIDZ INDONESIA: https://goo.gl/dBPaJ8 WOWKIDZ Español: https://goo.gl/Mx7PQD WOW TOONS: https://goo.gl/43AmBf MOTU PATLU: https://goo.gl/9g53Ac VIR THE ROBOT BOY: https://goo.gl/k48CzX WOW WORLD: https://goo.gl/xAZto6 CHACHA BHATIJA: https://goo.gl/N18LTt SELFIE WITH BAJRANGI: https://goo.gl/GjTgVy KISNA: https://goo.gl/Wb21mD
Views: 528090 Wow Kidz
[ENGSUB/CC] The Legend Of The Blue Sea Episode 13 Kiss Scene
 
02:27
Jun Ji Hyun _ Shim Chung / Se Hwa Lee Min Ho _ Heo Joon Jae / Kim Dam Ryung
Views: 22104722 Thu Trinh Võ
Seatrain - Orange Blossom Special
 
05:18
Seatrain - Orange Blossom Special
Views: 107643 Tom Snyder
ROBIN SCHULZ FEAT. ERIKA SIROLA – SPEECHLESS (OFFICIAL VIDEO)
 
03:36
Music: New single "Speechless" feat. Erika Sirola ► Get the single here: http://wmg.click/RobinSchulz_SpeechlessAY ► "Uncovered": http://wmg.click/RobinSchulz_UncoveredAY How do you like the video? Please comment below 👇 Visit Robin Schulz here: ►http://instagram.com/robin__schulz ►https://www.facebook.com/robin.schulz.official ►https://twitter.com/robin_schulz ►http://www.robin-schulz.com ►Snapchat: robinschulzreal Credits: An EASYdoesit Production (http://www.easydoesit.de) Director: Mario Clement DOP: Phillip Kaminiak Executive Producer: Sebastian von Gumpert Producer: Konstantin Nerger Producer India: Mikhail Mehra, Akshay Multani Associate Producer India: Surabhi Agarwal, Zeba Khan Line Producer: Another Idea/ Sachin Srivastava Production Designer: Vikram Singh Assistant Cinematographer: Ayaskant Baral 1st Assistant Director: Karanbir Ghumman 2nd Assistant Director: Pratik Punjabi 3rd Assistant Director: Lokesh Sharma Intern AD: Mallika Bajaj Hair and Make-up: Chriselle Baptista and team Costume Stylist: Divya Saini Choreographer: Avit Dias Production Manager: Sumit, Aakash, Ishaq Gaffer: Maulik Focus Puller: Aslam Light Vendor: Light n Light Camera Vendor: Mahadev Production Boys: Shiva and team Alround Bae`s: Findan Cote, Philip Malong Post-Production Producer: Emma Borg Editor: Christoph Szulecki Editor Assistants: Dennis Glomm & Jassin Aboura Sound: Moritz Staub Cast Lyla: Alexandra Tischenko Raahi: Rohit Mehra Head Chef and Tourist: Robin Schulz Client / Label: Warner Music / Kevin Segler The story of DJ and producer Robin Schulz reads like one in a million. Originally from the German city of Osnabrück, he is now a high-flying frequent traveller bringing his music to loyal followers across the globe and the epitome of a ‘pop phenomenon’: It’s been only four years since Robin Schulz first topped the worldwide singles charts with his acclaimed remix of “Waves (feat. Mr. Probz)” and landed his breakthrough global uber-hit “Prayer in C (feat. Lilly Wood & The Prick)”; practically an eternity in the 30-year-old artist’s fast-paced dance music cosmos! Building on his unique blend of house, electro and pop, the Osnabrück DJ and producer has meanwhile established himself as Germany’s most successful music export of the past two decades in record-breaking time, while his sure-fire megahits have proven to work crowds into a frenzy time and time again. With countless # 1 in over 20 countries, over 250 Gold and Platinum certifications as well as billions of streams and views to his name, the four-time German ECHO award-winner bares it all on his third studio album “Uncovered”! Robin Schulz now rings in the post-“Uncovered” era: A good year after releasing his successful last album, the German DJ and producer unleashes his brand-new single “Speechless” on November 16, featuring up-and-coming Finnish artist Erika Sirola on vocal duties. With its atmospheric production, Robin’s new track will arrest you from the get-go: “I remember how it all started / Feeling warm, though the summer was over / And our little lives they felt so big then“, Erika Sirola tells the story of a sizzling encounter that has all the ingredients for a big love story: “If you love me / Then say you love me / That you are mine", she sings, with jubilant synths and electrifying beats taking over in the chorus. With so many emotions involved, it’s hardly surprising one is left “Speechless”! #RobinSchulz #MusicVideo #Speechless #ErikaSirola #India
Views: 35802602 Robin Schulz
1k SUBS SPECIAL! MLP ♥Sea Swirls♥
 
01:20
OH MY GOD GUYS ARE YOU CRAZY? THIS MEANS SO MUCH FOR ME! THANK YOU SOOOOOOOO MUCH! ANOTHER SPECIAL SOON! :3 ___________________________________________________________________ song: Drop it - nightcore _________________________ Questions: How old are you? - Im 13 Years old ^^ Where do you live? - I live in germany Favourite Color? - Blue ^^ Do you have pets? - Yes, 2 Guniea Pigs and 2 Birds In wich Grade are you? - Im in 7th Grade c: When is your birthday? -On February 20th C: What do you use to draw? - I use MS Paint,Paint tool SAI and sometimes GIMP What do you use to record? -I use OBS C: ______________________________ Deviantart: BlueSkySilverSong Instagram: lpslolo78 ______________________________ DISCLAIMER: Copyright Disclaimer Under Section 107 of the Copyright Act 1976, allowance is made for "fair use" for purposes such as criticism, comment, news reporting, teaching, scholarship, and research. Fair use is a use permitted by copyright statute that might otherwise be infringing. Non-profit, educational or personal use tips the balance in favor of fair use. THIS VIDEO IS JUST FOR FUN. No copyright infringement intended. All rights to clips and music belong to their respective owners!
Views: 654 Sea Swirls
Sniper Strike: Special Ops - Gameplay Walkthrough part 1 - North Sea (iOS,Android)
 
26:31
Sniper Strike: Special Ops - Gameplay Walkthrough part 1 - North Sea (iOS,Android) Sniper Strike: Special Ops Walkthrough Playlist - https://www.youtube.com/playlist?list=PLj5n3gHxng9iHrB8dRIiZTseBcT3cArJB Subscribe - https://www.youtube.com/c/TanJinGames?sub_confirmation=1 Facebook - https://www.facebook.com/tan.jin.1000 Download on iTunes -https://itunes.apple.com/us/app/sniper-strike-special-ops/id1186805817?mt=8 Download on Google Play - https://play.google.com/store/apps/details?id=com.mgs.sniper1&hl=ru Sniper Strike: Special Ops - Free Description Intercept, eliminate and extract. It’s time to engage the enemy. Sniper Strike is a high-octane sniper experience that pits you in battle across three gameplay modes and hundreds of missions. Experience a AAA rated sniper game like never before on mobile. Scout through immersive environments, engage in rapid-fire combat and build the ultimate super-soldier as you customise their state of the art gear. Team up with Wolf, Jackson and the rest of Strike Force as you target hostiles and take down the evil Elite Order. Go head to head with friends in online combat and shoot to the top of the leaderboard. ● Wipe out Elite Commanders and their henchmen with satisfying kill shots! ● Buddy up with allies to cover Delta Team and rescue hostages. ● Seek out online friends (and foes) and challenge them to LIVE sniper duels! ● Join forces with Clan friends to smash missions, and prepare for the ultimate showdown with the Elite Order. ● The more you win, the better you play – upgrade and engage in harder, faster challenges that will send you flying up the leaderboard! Whether you're engaged in live PvP sniper duels, rescuing hostages with breach specialist Wolf, or fighting to be the last man standing in arena mode, this is one epic FPS experience that you don't want to miss! - .... .- -. -.- ... ..-. --- .-. . ...- . .-. -.-- .-.. .. -.- . .- -. -.. ..-. .- ...- --- .-. .. - .
Views: 12940 TanJinGames
Sniper Strike: Special Ops - Gameplay Walkthrough part 2 - North Sea (iOS,Android)
 
17:09
Sniper Strike: Special Ops - Gameplay Walkthrough part 2 - North Sea (iOS,Android) Sniper Strike: Special Ops Walkthrough Playlist - https://www.youtube.com/playlist?list=PLj5n3gHxng9iHrB8dRIiZTseBcT3cArJB Subscribe - https://www.youtube.com/c/TanJinGames?sub_confirmation=1 Facebook - https://www.facebook.com/tan.jin.1000 Download on iTunes -https://itunes.apple.com/us/app/sniper-strike-special-ops/id1186805817?mt=8 Download on Google Play - https://play.google.com/store/apps/details?id=com.mgs.sniper1&hl=ru Sniper Strike: Special Ops - Free Description Intercept, eliminate and extract. It’s time to engage the enemy. Sniper Strike is a high-octane sniper experience that pits you in battle across three gameplay modes and hundreds of missions. Experience a AAA rated sniper game like never before on mobile. Scout through immersive environments, engage in rapid-fire combat and build the ultimate super-soldier as you customise their state of the art gear. Team up with Wolf, Jackson and the rest of Strike Force as you target hostiles and take down the evil Elite Order. Go head to head with friends in online combat and shoot to the top of the leaderboard. ● Wipe out Elite Commanders and their henchmen with satisfying kill shots! ● Buddy up with allies to cover Delta Team and rescue hostages. ● Seek out online friends (and foes) and challenge them to LIVE sniper duels! ● Join forces with Clan friends to smash missions, and prepare for the ultimate showdown with the Elite Order. ● The more you win, the better you play – upgrade and engage in harder, faster challenges that will send you flying up the leaderboard! Whether you're engaged in live PvP sniper duels, rescuing hostages with breach specialist Wolf, or fighting to be the last man standing in arena mode, this is one epic FPS experience that you don't want to miss! - .... .- -. -.- ... ..-. --- .-. . ...- . .-. -.-- .-.. .. -.- . .- -. -.. ..-. .- ...- --- .-. .. - .
Views: 13671 TanJinGames

More videos »

Dream & Visions: Spiders & Webs
 
08:06
What do spiders mean in dreams? How about webs? * Based on the teachings of John Paul Jackson
Views: 85 Lynn Hardy
#34 Dreams About Spider Webs - Meaning & Interpretation
 
07:45
When you have this type of dream, this can be a sign that you will you have an important matter in your life that you have been unable to find an appropriate solution to, although you might have been able to wave it off quite a number of times, you are yet to find the right solution to these problems. Read more : https://alodreams.com/dreams-about-spider-webs.html
System Of A Down - Spiders
 
03:36
System of a Down's official music video for 'Spiders'. Click to listen to System of a Down on Spotify: http://smarturl.it/SystemSpotify?IQid=SystemSpiders As featured on System of a Down. Click to buy the track or album via iTunes: http://smarturl.it/SystemSOAD?IQid=SystemSpiders Google Play: http://smarturl.it/SpidersGPlay?IQid=SystemSpiders Amazon: http://smarturl.it/SOADAmazon?IQid=SystemSpiders More from System of a Down Chop Suey!: https://youtu.be/CSvFpBOe8eY Aerials: https://youtu.be/L-iepu3EtyE B.Y.O.B: https://youtu.be/zUzd9KyIDrM More great Alternative videos here: http://smarturl.it/Alternative00?IQid=SystemSpiders Follow System of a Down Website: http://www.systemofadown.com/ Facebook: https://www.facebook.com/systemofadown Twitter: https://twitter.com/systemofadown Instagram: https://instagram.com/systemofadown/ Subscribe to System of a Down on YouTube: http://smarturl.it/SYODSub?IQid=SystemSpiders --------- Lyrics: The piercing radiant moon, The storming of poor June, All the life running through her hair, Approaching guiding light, Our shallow years in fright, Dreams are made winding through my head, Through my head, Before you know, Awake, Your lives are open wide, The V-chip gives them sight, All the life running through her hair, The spiders all in tune, The evening of the moon, Dreams are made winding through my head, Through my head, Before you know, Awake
Views: 83044046 systemofadownVEVO
Lucas the Spider - Spinning Webs
 
00:45
Lucas the Spider isn’t just cute and funny animal, he’s smart too! He isn't about to let a little adversity keep him down. Anything is possible for this animal because he dreams big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 9258997 Lucas the Spider
blink-182 - I Miss You (Official Video)
 
03:50
Music video by blink-182 performing I Miss You. (C) 2003 Geffen Records #Blink192 #IMissYou #Vevo
Views: 230579856 blink182VEVO
Thousands Of Spiders Built Massive Communal Webs In Texas
 
01:08
In the Dallas suburb of Rowlett, thousands of tiny spiders have covered a series of trees with webs in a communal food-catching effort that has some residents a bit freaked out. Typically, you'd see a spider working by itself to build a web.  However, on a football-field length of CA Roan Drive in Rowlett, Texas, thousands of spiders have come together to build a massive series of communal webs 40 feet into the trees.  The species of spider responsible for the community-oriented web construction is not yet known, but is likely to be a member of the Tetragnathidae family, who made similar shroud-like work in neighboring Lake Tawakoni State Park in 2007.  Mike Merchant, an urban entomologist from Texas A&M's AgriLife Extension Service, explained, “Arachnologists had previously noted that this species is known to build communal nests when conditions are right. But it is rare to see them building such large nests in the U.S. Spider experts have indicated that those ‘right conditions’ appear to include a glut of small insects like midges that emerge at night from lakes.”  And the insects from nearby Lake Ray Hubbard seem to fit the bill.  The spiders pose no harm to humans, and similar works of arachnid art have also been spotted in Sindh, Pakistan—where flooding, not food, forced some spiders into the trees as well.
Views: 191167 GeoBeats News
How does a Spider make its web? | #aumsum
 
05:23
On its underside, a spider has organs called spinnerets that spin silk threads. First, it connects two end points like two branches with silk threads, forming a bridge. It then releases a loose thread. From its center, it adds a new thread, pulling it to form a Y shape. It joins the 3 points to form a frame. Then lays radial threads till the web becomes strong enough. Finally, from the center, it spins spirally completing the web.
Views: 143299 It's AumSum Time
Social Spiders Spin Massive Nest
 
03:29
Social spiders can build nests more than 20 feet across. Please LIKE and SUBSCRIBE if you enjoyed! http://bit.ly/1Adl6ht **More info & videos below** A spider found in parts of the Caribbean and South America forms colonies that comprise thousands of individuals. Working together these colonies can build nests more than 20 feet across. "Animal Homes: Cities" premieres April 22, 2015 at 8/7c on PBS. Check your local listings. http://www.pbs.org/wnet/nature/animal-homes/11674/ --- For full NATURE episodes, check out http://www.pbs.org/wnet/nature/ Facebook: http://www.facebook.com/pbsnature/ Twitter: http://twitter.com/pbsnature/ Tumblr: http://pbsnature.tumblr.com/ Instagram: http://instagram.com/pbs_nature/ ----------------- Nature is a production of THIRTEEN for PBS. Throughout its history, Nature has brought the natural world to millions of viewers. The PBS series has been consistently among the most-watched primetime series on public television. ----------------- More videos: Sea otter orphan gets adopted: https://www.youtube.com/watch?v=qdy7DEhvsVU Owl silent flight: https://www.youtube.com/watch?v=6pWub12DUoU Bullfrog dad protects tadpoles: https://www.youtube.com/watch?v=l3uO2lO9JDk Gorilla mating games: https://www.youtube.com/watch?v=3431b8twU-U Snow Monkeys behind the scenes: https://www.youtube.com/watch?v=dDusYMTcyg4
Views: 39401 Nature on PBS
First Ever Video of Silkhenge Spider Birth
 
03:23
Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made? For any licensing requests please contact [email protected] Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below: Web tower-COI-5P GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATAAATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAATGAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCATAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAAATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT Link to the BLAST website where we aligned the piece of DNA https://blast.ncbi.nlm.nih.gov We found a total of 5 silkhenge structures and watched three spiders hatch from this. Filmed on an olloclip and Canon 70D. Subscribe to Aaron's channel on YouTube: https://www.youtube.com/channel/UCHr0u7Jsktou2CFl2GhTxYA Visit Yasuni Naitonal Park at http://www.Yasuni.ec Special thanks to Tropical Herping for guiding us through to Yasuni. Want to visit there? Check them out: http://tropicalherping.com/
Views: 1680207 The Jungle Diaries

More videos »

Try YouTube in a new web browser!
Download Google Chrome

WORKFORCE 100 METHODOLOGY

The Workforce 100 is the rank order and scores of the 100 companies that performed best in seven core areas: workplace culture, employee benefits, diversity and inclusion, employee development and talent management, human resources innovation, leadership development and talent acquisition. The working assumption behind the list is that high performance in these core categories provides a reasonable proxy for overall HR excellence. To create the ranking, researchers at the Human Capital Media Advisory Group, the research arm of Workforce magazine, collected available public data from a representative list of established benchmarking and ranking programs in the identified categories and partnered with Glassdoor to include data on employee satisfaction in key areas. This allowed researchers to generate a score based equally on depth and breadth of outside recognition and internal recognition. The reason for this change in methodology was to create a ranked list that made comprehensive HR participation and employee feedback on their respective employers the primary focus rather than excellence in one core area. Using this method, organizations that are recognized on multiple lists but do not perform perfectly will be ranked higher than organizations that are ranked in one area but perform better in a single discipline. In addition, organizations that are not as heavily represented in external recognition programs are still acknowledged for their HR efforts through the posted opinions of their employees. To generate the score, researchers first looked at how many lists with HR relevance a particular company appeared on, which makes up half of the total score (maximum of 5 points). The other half of the score (also with a maximum of 5 points) was derived from an average of the company’s Glassdoor performance in areas pertaining to HR. These scores are then added together to create the final score.