Home
Search results “Dreaming with spiders and webs”
System Of A Down - Spiders
 
03:36
System of a Down's official music video for 'Spiders'. Click to listen to System of a Down on Spotify: http://smarturl.it/SystemSpotify?IQid=SystemSpiders As featured on System of a Down. Click to buy the track or album via iTunes: http://smarturl.it/SystemSOAD?IQid=SystemSpiders Google Play: http://smarturl.it/SpidersGPlay?IQid=SystemSpiders Amazon: http://smarturl.it/SOADAmazon?IQid=SystemSpiders More from System of a Down Chop Suey!: https://youtu.be/CSvFpBOe8eY Aerials: https://youtu.be/L-iepu3EtyE B.Y.O.B: https://youtu.be/zUzd9KyIDrM More great Alternative videos here: http://smarturl.it/Alternative00?IQid=SystemSpiders Follow System of a Down Website: http://www.systemofadown.com/ Facebook: https://www.facebook.com/systemofadown Twitter: https://twitter.com/systemofadown Instagram: https://instagram.com/systemofadown/ Subscribe to System of a Down on YouTube: http://smarturl.it/SYODSub?IQid=SystemSpiders --------- Lyrics: The piercing radiant moon, The storming of poor June, All the life running through her hair, Approaching guiding light, Our shallow years in fright, Dreams are made winding through my head, Through my head, Before you know, Awake, Your lives are open wide, The V-chip gives them sight, All the life running through her hair, The spiders all in tune, The evening of the moon, Dreams are made winding through my head, Through my head, Before you know, Awake
Views: 77649180 systemofadownVEVO
SPIDER WEBS!!! Super powerful!
 
06:04
Heres a quick witchy tidbit on spider webs and their uses. We are collecting some we have been letting grow for a bit and will be using them soon! Do throw yours out! Keep them! They can kick some serious ass for you!
Views: 258 Hex Arcanum
Lucas the Spider - Spinning Webs
 
00:45
Lucas the Spider isn’t just cute and funny animal, he’s smart too! He isn't about to let a little adversity keep him down. Anything is possible for this animal because he dreams big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 6286031 Lucas the Spider
Spider as a Spirit Guide--What it Means When You Are Suddenly Seeing Spiders Everywhere
 
25:26
This video will teach you everything you ever wanted to know about what it means when Spider shows up as a spirit guide for you (You are suddenly getting spider-bites, seeing spiders everywhere, are feeling a new fear of or affection for spiders, people start sending you pictures and cards and gifts with spiders, etc.). You will learn how Spider can teach you how to create a happier life for yourself--especially with regard to money!, how to tackle challenges that feel too big to handle and how to deal with issues of feeling afraid and/or victimized. And if you're not sure if Spider is simply acting as your current spirit guide or is instead your personal totem, you can check out my video on the difference between totems and spirit guides, as well as my upcoming video, "Spider as a Totem" (Coming within the next two weeks, so stay posted!).
Views: 36668 Jordana Van
Spiders Blanket Creek in Webs—a Surreal, Rare Sight | Nat Geo Wild
 
01:38
Long-jawed spiders spun webs that blanketed the trees and bushes of Nahal Soreq Creek near Jerusalem. ➡ Subscribe: http://bit.ly/NatGeoWILDSubscribe About National Geographic Wild: National Geographic Wild is a place for all things animals and for animal-lovers alike. Take a journey through the animal kingdom with us and discover things you never knew before, or rediscover your favorite animals! Get More National Geographic Wild: Official Site: http://bit.ly/NatGeoWILD Facebook: http://bit.ly/NGWFacebook Twitter: http://bit.ly/NGWTwitter Instagram: http://bit.ly/NGWInstagram These arachnids are normally solitary. But in this rare instance, there are millions of them residing along this creek. The area is also infested with mosquitoes that the spiders feast upon. Spiders Blanket Creek in Webs—a Surreal, Rare Sight | Nat Geo Wild https://youtu.be/ED-xRJrtuHY Nat Geo Wild https://www.youtube.com/user/NatGeoWild
Views: 10490 Nat Geo WILD
No Doubt - Spiderwebs
 
04:04
Best of No Doubt: https://goo.gl/arujs7 Subscribe here: https://goo.gl/HRNLKB Music video by No Doubt performing Spiderwebs. (C) 2003 Interscope Records
Views: 16748792 NoDoubtVEVO
System of a Down - Spiders Lyrics
 
03:37
https://soundcloud.com/g-karal
Views: 2939457 C.arlos
Bug Spray Kills Spider, Spawns Nightmare
 
01:41
#Outrageous_Acts Wednesdays 9/8c on Science Channel When Australian Brent Askwith gave this spider the bug spray treatment, nature inflicted her cold revenge by birthing nightmares all over his floor. http://www.sciencechannel.com/tv-shows/outrageous-acts-of-science/ Full episodes streaming FREE on Science GO: https://www.sciencechannelgo.com/outrageous-acts-of-science/ Check out Brent Askwith's YouTube channel: https://www.youtube.com/user/baskwith Subscribe to Science Channel: http://www.youtube.com/subscription_center?add_user=sciencechannel Check out SCI2 for infinitely awesome science videos. Every day. http://bit.ly/SCI2YT
Views: 18788886 Science Channel
Thousands Of Spiders Built Massive Communal Webs In Texas
 
01:08
In the Dallas suburb of Rowlett, thousands of tiny spiders have covered a series of trees with webs in a communal food-catching effort that has some residents a bit freaked out. Typically, you'd see a spider working by itself to build a web.  However, on a football-field length of CA Roan Drive in Rowlett, Texas, thousands of spiders have come together to build a massive series of communal webs 40 feet into the trees.  The species of spider responsible for the community-oriented web construction is not yet known, but is likely to be a member of the Tetragnathidae family, who made similar shroud-like work in neighboring Lake Tawakoni State Park in 2007.  Mike Merchant, an urban entomologist from Texas A&M's AgriLife Extension Service, explained, “Arachnologists had previously noted that this species is known to build communal nests when conditions are right. But it is rare to see them building such large nests in the U.S. Spider experts have indicated that those ‘right conditions’ appear to include a glut of small insects like midges that emerge at night from lakes.”  And the insects from nearby Lake Ray Hubbard seem to fit the bill.  The spiders pose no harm to humans, and similar works of arachnid art have also been spotted in Sindh, Pakistan—where flooding, not food, forced some spiders into the trees as well.
Views: 176461 GeoBeats News
Spider-Man Movie (2002) - Peter's New Powers Scene (2/10) | Movieclips
 
03:04
Spider-Man - Peter's New Powers: Peter (Tobey Maguire) discovers his new web-slinging abilities. BUY THE MOVIE: http://bit.ly/2ggcqEY Watch the Best Spider-Man Scenes & Clips: Spider-Man Best Scenes Playlist: http://j.mp/2h4nnX0 About Spider-Man Movie: After incorporating elements of comic book style and design into many of his films, director Sam Raimi helms this straight-ahead, big-budget comic book adaptation, which also marks acclaimed young actor Tobey Maguire's first dip into live-action blockbuster filmmaking. Spider-Man follows the template of the original Stan Lee/Steve Ditko source material, with hero Peter Parker an orphaned, intellectual teen loner living in Queens with his aunt (Rosemary Harris) and uncle (Cliff Robertson), and dreaming of the girl next door, Mary Jane (Kirsten Dunst). On a field trip to a Columbia University lab, Peter is bitten by a genetically altered spider and overnight he gains superhuman strength, agility, and perception. At first, Peter uses his powers for material gain, winning a wrestling match with a purportedly lucrative prize. But when Peter apathetically fails to stop a burglar from robbing the wrestling arena, a tragedy follows that compels him to devote his powers to fighting crime -- as the superhero Spider-Man. When he's not busy fighting crime in a spider suit, Peter moves into an apartment with his best friend, Harry (James Franco), and begins work as a photographer at the Daily Bugle. Meanwhile, his do-gooder alter ego finds a nemesis in the form of the Green Goblin (Willem Dafoe), a super-powered, megalomaniacal villain who happens to be the alter ego of Harry's father, weapons-manufacturing mogul Norman Osborn. Spider-Man was written by the prolific blockbuster scribe David Koepp (Jurassic Park, Panic Room). CREDITS: TM & © Sony (2002) Cast: Tobey Maguire Director: Sam Raimi Producers: Avi Arad, Ian Bryce, Grant Curtis, Heidi Fugeman, Stan Lee, Steven P. Saeta, Laura Ziskin Screenwriters: Steve Ditko, David Koepp, Stan Lee About Movieclips: Subscribe for more Movie Clips: http://bit.ly/1u2yaWd Like us on FACEBOOK: http://on.fb.me/1y8M8ax Follow us on TWITTER: http://bit.ly/1ghOWmt Pinterest: http://bit.ly/14wL9De Tumblr: http://bit.ly/1vUwhH7 The MOVIECLIPS channel is the largest collection of licensed movie clips on the web. Here you will find unforgettable moments, scenes and lines from all your favorite films. Made by movie fans, for movie fans.
Views: 39208630 Movieclips
blink-182 - I Miss You
 
03:50
Music video by blink-182 performing I Miss You. (C) 2003 Geffen Records
Views: 206379294 blink182VEVO
Watch: spiders weave giant webs in forest near Jerusalem
 
02:31
On the banks of a creek near Jerusalem, part of a forest is enveloped in what looks like giant netting. Long-jawed spiders spin huge cobwebs, shrouding trees that glisten in the sunshine. The unusual sight in the Soreq creek is thanks to a combination of factors. Treated sewage full of nutrients promote the proliferation of mosquitoes that serve as a source of food for spiders, which then reproduce in multitudes. … READ MORE : http://www.euronews.com/2017/11/09/watch-spiders-weave-giant-webs-in-forest-near-jerusalem What are the top stories today? Click to watch: https://www.youtube.com/playlist?list=PLSyY1udCyYqBeDOz400FlseNGNqReKkFd euronews: the most watched news channel in Europe Subscribe! http://www.youtube.com/subscription_center?add_user=euronews euronews is available in 13 languages: https://www.youtube.com/user/euronewsnetwork/channels In English: Website: http://www.euronews.com/news Facebook: https://www.facebook.com/euronews Twitter: http://twitter.com/euronews Google+: http://google.com/+euronews VKontakte: http://vk.com/en.euronews
Views: 13577 euronews (in English)
Blink 182 - I Miss you
 
03:42
Blink 182 I Miss You Lyric Rate and Comment Please copyright goes to blink 182
Views: 29384359 SgtFireEles
Techno Trance - Dreaming Of You
 
06:45
spac3trance.webs.com and http://www.facebook.com/israel.armendariz.9 for all my big fans out there :P Sorry I've been gone for so long guys, but I'm finally glad to be back :D Love this song, Link to pic http://spac3trance.webs.com/apps/photos/photo?photoid=75771110 Enjoy guys!
Views: 57001 Techno Trance Channel
This Puppy-Sized Spider Will Haunt Your Dreams
 
01:12
According to the Guinness Book of World Records, the world’s largest spider is the Goliath birdeater native to South America. These huge spiders can weigh more than 6 ounces, with legs spanning up to a foot. According to the Guinness Book of World Records, the world’s largest spider is the Goliath birdeater. Native to South America, these huge spiders can weigh more than 6 ounces, with legs spanning up to a foot. Piotr Naskrecki, an entomologist and photographer at Harvard University's Museum of Comparative Zoology, studied the birdeater spiders, and compared them to the size of a puppy. While some experts think that the giant huntsman spider is larger because of its impressive leg span, the birdeater spiders are actually more massive. They are named birdeaters because one was observed eating a hummingbird, but their diet mainly consists of earthworms and other small animals they find on the ground in their jungle habitat. Even though these spiders aren’t deadly to humans, they can still inflict some damage with their two inch fangs. They also have microscopic barbs on their hair that when stuck on a predator, can cause pain, itchiness, and discomfort for days. Naskrecki is quoted as saying: "I've been working in the tropics in South America for many, many years, and in the last 10 to 15 years, I only ran across the spider three times." He captured one female specimen in Guyana, which was given to a museum after being studied.
Views: 3153545 GeoBeats News
Thousands of swarming spiders carpet Arkansas highway with thick webs - Daily News
 
03:02
Thousands of swarming spiders carpet Arkansas highway with thick webs - Daily News https://www.youtube.com/channel/UCGIQ4XcqArGYqiw70QoKcvw?sub_confirmation=1 Arachnid,invasion,Thousands,swarming,spiders,carpet,Arkansas,highway,webs An Arkansas man captured the terrifying scene of thousands of spiders swarming alongside a highway.Zach Riggs, of Jonesboro, Arkansas, was driving along Highway 230, near Bono, Arkansas, when he came across the nightmare situation, according to Fox News.  Riggs stopped and, naturally, took video and photos which he then shared on Facebook on November 6 with the caption, 'Anybody need some spiders?'  In the video, Riggs gives viewers and up close and personal look at the spiders covering a highway construction barricade. At first glance, the plastic sawhorse looks like it's covered in dirt.  But upon closer inspection, it's clear that it is actually an astonishing number of arachnids jumbled on top of each other. Riggs can be seen bravely holding out his hand near the spiders, which waste no time crawling over his palm.  The series of photos that Riggs posted reveal that thick, white spiderwebs cover the grass on the side of the road, brushes, metal road signs and even spindly trees. It's believed that the spiders seen in the now-viral video and photos are Tetragnatha spiders. The so-called 'stretch spiders' have long bodies and are common in tropical climates.     AccuWeather stated that the area near Bono has been very moist due to recent storms and that some spider species are attracted to those conditions.  Share this article Share This isn't the first time that such a frightening scene has caught the eye of a passerby, however. In September, a man in Aitoliko, Greece, shared similar images online, showing a nearly 1,000-foot spiderweb blanketing a local beach which was determined to be a kind of 'mating party'. Democritus University of Thrace biology professor Maria Chatzaki said that 'It's as if the spiders are taking advantage of these conditions and are having a kind of a party,' according to a translation by the BBC. 'They mate, they reproduce and provide a whole new generation.'After mating beneath the webs, Chatzaki said, the spiders would then die.Tetragnatha spiders are not deemed dangerous for people and don't cause any damage to nearby flora.
Views: 3095 NY Daily News
Walking into spider webs
 
01:54
Compilation video of people's reactions to walking into spider webs.
Views: 12444 Article Cats
A Plague Of Spiders Has Completely Covered An Australian Town In Webs
 
02:05
Imagine waking up to a beautiful snow blanketed field outside of your picturesque farm. But wait… it’s still summer so obviously that couldn’t be snow. You walk outside your front door to take a closer look and immediately your skeleton jumps out of your skin from the most disturbing sight you’ve ever seen! Spiders! Millions and millions of creepy crawly spiders! That’s exactly what happened in a small town in Australia called Wagga Wagga. Recent floods have covered miles and miles of once lush green land with feet of muddy water. This caused the evacuation of over 13,000 people. Well, naturally spiders aren’t the biggest fans of detrimental water levels either so they took to the hills. Millions of spiders had to migrate to higher ground to escape the flooding. This caused an extreme population of the evil little creatures to congregate in one small area. Take a look at these horrifying images that are causing nightmares around the world. This is why you want to stay far away from Australia. -~-~~-~~~-~~-~- Please watch: "This Navy Man Reunited With His Son After Weeks Away Then He Discovered His Wife Had Been Lying1" https://www.youtube.com/watch?v=J7dER2ocfTk -~-~~-~~~-~~-~-
Views: 852 Behind The World
The Spider's Web: Britain's Second Empire (Documentary)
 
01:18:02
At the demise of empire, City of London financial interests created a web of secrecy jurisdictions that captured wealth from across the globe and hid it in a web of offshore islands. Today, up to half of global offshore wealth is hidden in British jurisdictions and Britain and its dependencies are the largest global players in the world of international finance. The Spider's Web was written, directed and produced by Michael Oswald, you can sponsor his future films on Patreon: https://www.patreon.com/independentdocumentary Share this documentary with your friends, and ask sites to feature it: https://twitter.com/spiderswebfilm https://www.facebook.com/Spiderswebfilm/ https://www.imdb.com/title/tt6483026/ The Spider's Web was substantially inspired by Nicholas Shaxson's book Treasure Islands you can read an extract of it here: https://www.theguardian.com/theguardian/2011/jan/08/jersey-tax-haven-nicholas-shaxson Translate this documentary here on youtube or contact us for the .srt file [email protected] For those interested to learn more about tax justice and financial secrecy, read about the Tax Justice Network's campaigning and regular blogs - become part of the movement for change and listen to the Tax Justice Network's monthly podcast/radio show the Taxcast https://www.taxjustice.net/taxcast/ Review on Filmotomy: https://filmotomy.com/the-spiders-web-britains-second-empire/ Review on Open Democracy: https://www.opendemocracy.net/neweconomics/film-review-spiders-web-britains-second-empire/ Website: www.spiderswebfilm.com German Version: https://youtu.be/1ZZR8vBKqwc Spanish Version: https://www.youtube.com/watch?v=85dsTnbhchc French Version: https://www.youtube.com/watch?v=hizj_6EH34M Italian Version: https://www.youtube.com/watch?v=VwmvXLamkto&t=1s Subtitles: French, Spanish, German, Italian, Russian, Arabic, Korean, Hungarian, English, Turkish, Portugese.
Views: 1087957 Independent POV
Spiders Dream - Atmosphere 2003
 
02:08
A spider's happy Sunday dream. Directed by: Claire Merrick Produced for the Meniscus Film Festival's short film competition in 2003 under the theme 'Atmosphere'. For more information Meniscus events and film evenings visit us at www.meniscusfilms.com
Views: 178 meniscusfilms
Australian Spiders and Webs - Close Ups of Common House Spiders
 
01:31
Imagine accidentally walking into these webs with these friendly arachnids crawling over you ... Really these are just some common Australian spiders found outside around the house and yard. At a guess, I think these are Golden Orb Weavers and St Andrews Cross spiders .... Music credit - Classic Horror 1 - Kevin MacLeod (incompetech.com) Shot with a Panasonic GH2 14-42mm lens f3.5-5.6 Edited in Adobe Premiere Pro CS6
Views: 2366 Michael Sealey
Coldplay - Trouble
 
04:53
Get A Head Full Of Dreams now: – iTunes http://cldp.ly/cpitunes – Amazon http://smarturl.it/AHFODamazon – Google Play http://smarturl.it/AHFODgplay – CD (with exclusive holographic stickers) http://smarturl.it/AHFODcd – Vinyl (with exclusive holographic stickers) http://smarturl.it/AHFODvinyl ~ Follow Coldplay ~ Website: http://www.coldplay.com Twitter: https://twitter.com/coldplay Facebook: https://www.facebook.com/coldplay Instagram: http://instagram.com/coldplay Google+: http://instagram.com/coldplay Tumblr: http://coldplay.tumblr.com/ VK: https://vk.com/coldplay
Views: 103444285 Coldplay
It's raining spiders! Spider rain phenomenon explained
 
02:12
After a small Australian town was recently covered by spiders raining from the sky, we explain what exactly spider rain is. Report by Claire Lomas.
Views: 848318 ODN
A spider dreams
 
03:04
A spider weaves her web, round and round and pulling the delicate material she needs from her own body. She has everything she needs already within her, and she is naturally skilled to build her life with what she has. She dreams, she builds she rests for a moment and then continues patiently, and courageously. At any moment, anything at all could destroy all she has done, and waste all the strands her body has produced. Still she spins, and dreams, and weaves her dream into every moment, into every circle, and through every breeze or falling leaf.
The Cure - Lullaby (Official Music Video)
 
04:10
Watch the official video for 'Lullaby' by The Cure from the 1989 album Disintegration Subscribe to the Rhino Channel! http://bit.ly/SubscribeToRHINO Check Out Our Favorite Playlists: Rhino Favorite 100 http://bit.ly/RhinoFavorite100 80s Hits http://bit.ly/80sMusicHits Classic Rock http://bit.ly/ClassicRockFavorites Stay connected with RHINO on... Facebook https://www.facebook.com/RHINO/ Instagram https://www.instagram.com/rhino_records Twitter https://twitter.com/Rhino_Records https://www.rhino.com/ Stay connected with The Cure on... Facebook https://www.facebook.com/thecure/ http://www.thecure.com/ RHINO is the official YouTube channel of the greatest music catalog in the world. Founded in 1978, Rhino is the world's leading pop culture label specializing in classic rock, soul, and 80's and 90's alternative. The vast Rhino catalog of more than 5,000 albums, videos, and hit songs features material by Warner Music Group artists such as Van Halen, Duran Duran, Aretha Franklin, Ray Charles, The Doors, Chicago, Black Sabbath, John Coltrane, Yes, Alice Cooper, Linda Ronstadt, The Ramones, The Monkees, Carly Simon, and Curtis Mayfield, among many others. Check back for classic music videos, live performances, hand-curated playlists, the Rhino Podcast, and more!
Views: 5437274 RHINO
Spiders and Webs (with Calming music) Step-wise progression get over fear of spiders
 
11:55
Music used with permission by Jason "JT" Thomas and BorthWarmonger Music, Copyright 2010. Livin' the Blues Again, Throw-Down, Harney St. Wranglers Ver la araña y escuchar música. Se edderkop og lytte til musik . Kijk naar de spin en naar muziek luisteren . Spektu la araneo kaj aŭskulti muzikon . Panoorin ang mga spider at makinig sa musika. Katsellahämähäkki ja kuunnella musiikkia . Regarder l'araignée et écouter de la musique . Siehe die Spinne und Musik hören . Παρακολουθήστε την αράχνη και να ακούσετε μουσική . Gade Spider an epi koute mizik. Horfa kónguló og hlusta á tónlist . Perhatikan laba-laba dan mendengarkan musik . Féach ar an damhán alla agus éisteacht le ceol . Guarda il ragno e ascoltare la musica . クモを見て、音楽を聴きます。 거미 를보고 음악을 들을 수 있습니다. Skatīties zirnekļa un klausīties mūziku . Uita-te la păianjen și de a asculta muzică . స్పైడర్ సంగీతం చూడటానికి మరియు వినడానికి. মাকড়সা এবং ঘড়ি সঙ্গীত শুনতে . buibui na kusikiliza muziki . यस माकुरा हेर्नुहोस् र संगीत सुन्न । Titta på spindel och lyssna på musik. Se edderkoppen og lytte til musikk . Դիտելու spider եւ լսել երաժշտություն: মাকড়সা এবং ঘড়ি সঙ্গীত শুনতে .
Views: 1238 CallOTChrissy
Lucas The Spider - One Man Band
 
00:58
What animal do you know can play multiple instruments? Lucas the Spider, that’s who! Anything is possible if you dream big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 5017330 Lucas the Spider
Spider Totem: Spirit Meaning of Spider
 
19:11
Do you identify with Spiders (or do they scare the pants off of you)? Has #Spider appeared to you lately in dreams or other ways? Spider may be your #totem animal, or perhaps it is a #poweranimal guide with a message for you. Listen in for insights into the #spiritanimal meaning of Spider. Check out my Spirit Animal Awareness oracle card deck here: https://www.etsy.com/listing/642491331/spirit-animal-awareness-oracle-card-deck?ref=shop_home_active_1 If you would like personal guidance in understanding your Spider dreams or experiences, you can book a reading with me here: https://spiritanimaloracle.as.me/schedule.php?appointmentType=category%3ASpirit+Animal+readings
Views: 8193 Christie Martin
Lucas the Spider - Captured
 
00:31
Oh no, Lucas the Spider may or may not know that he is in danger! What will happen? This spider will have to dream big to get out of this one! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 18775279 Lucas the Spider
"Dreaming" - Webs (Sabre Ronzh's Ep.)
 
01:38
Thanks for watching, ops in comments? LIKE, SHARE, SUBSCRIBE!!!
Views: 89 Webs VFX
Inland Empire -- David Lynch Pre-Show
 
00:34
David Lynch plays keyboard before a screening of Inland Empire. His Thought: 'we are spiders who weave webs, and then live in our webs... We are dreamers who dream, and then live in our dreams.'(Paraphrased)
Views: 3018 cbarry518
Giant Spiders! Goliath Birdeater Tarantula Update (World's BIGGEST Spiders!)
 
15:57
Update on my 6 pet Burgundy Goliath bird eating tarantulas (Theraphosa stirmi)! These gorgeous South American spiders are arguably the largest species of spider in the world! I hope you’ll enjoying seeing them + how they've been doing! Tom's Big Spiders: https://tomsbigspiders.com/ Thank you to Anne Mack for her video contribution and Martin Gamache for his photo. ____________________________________________________________________ My camera: https://amzn.to/2Iivmge My Gear: Light ring: https://amzn.to/2L2fznK _______________________________________________________________ Follow me on: https://www.facebook.com/Reptiliatus-... https://www.instagram.com/reptiliatus... https://www.facebook.com/PhantasticGe... _______________________________________________________________ Photo of individual affected by tarantula urticating hairs is Dan/courtesy of TarantulaDan: https://www.youtube.com/user/Tarantul... _______________________________________________________________ Music by: Andrew Applepie: https://soundcloud.com/andrewapplepie
Views: 22718 Reptiliatus
First Ever Video of Silkhenge Spider Birth
 
03:23
Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made? For any licensing requests please contact [email protected] Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below: Web tower-COI-5P GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATAAATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAATGAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCATAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAAATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT Link to the BLAST website where we aligned the piece of DNA https://blast.ncbi.nlm.nih.gov We found a total of 5 silkhenge structures and watched three spiders hatch from this. Filmed on an olloclip and Canon 70D. Subscribe to Aaron's channel on YouTube: https://www.youtube.com/channel/UCHr0u7Jsktou2CFl2GhTxYA Visit Yasuni Naitonal Park at http://www.Yasuni.ec Special thanks to Tropical Herping for guiding us through to Yasuni. Want to visit there? Check them out: http://tropicalherping.com/
Views: 1647191 The Jungle Diaries
spiders and the webs earcuff for Halloween - Halloween jewelry idea 266
 
19:53
DIY wire jewelry spiders and the webs earcuff for Halloween - Halloween jewelry idea I'm not trained, I just follow instinct, I work according to personal preferences like a way of entertainment. I'm trying to learn every day to be able do more guidance in the future. I also hope to inspire more people. if you are a beginner, you should watch a simple form in advance to be able to keep up with more complex patterns. When you know the basics, you can freely create different patterns based on your imagination. I just give how to make for reference, You can do the way you want, And maybe you will do better than me Rings: https://goo.gl/9u6ems Bracelets: https://goo.gl/rH1MtZ Pendants: https://goo.gl/jWxKdM Earrings, Ear cuff: https://goo.gl/nyLFNN Necklaces, hairpin: https://goo.gl/LxFbhr Decorations: https://goo.gl/hWH2FB Flower, leaf and natural : https://goo.gl/VHEh2H Animal : https://goo.gl/UzdJ6d
Views: 86880 Lan Anh Handmade
Thread Web | English | Dream Catcher
 
03:51
Weave a single length of thread on a ring to make very exquisite and geometric patterns called - Dream Catchers. You can use color wool to make lend them colors of the rainbow. And use old Coke Bottles to make the most elegant gifts for your friends! This work was supported by IUCAA and Tata Trust. This film was made by Ashok Rupner TATA Trust: Education is one of the key focus areas for Tata Trusts, aiming towards enabling access of quality education to the underprivileged population in India. To facilitate quality in teaching and learning of Science education through workshops, capacity building and resource creation, Tata Trusts have been supporting Muktangan Vigyan Shodhika (MVS), IUCAA's Children’s Science Centre, since inception. To know more about other initiatives of Tata Trusts, please visit www.tatatrusts.org
Views: 327584 Arvind Gupta
Unboxing my Dream Tarantulas
 
12:58
Isaiah and I unpack our dream tarantulas. We're all very excited and Happy. Stay tuned for a P.vittata rehouse as I found the perfect cage. Thanks Paul for the package, you're the best
Views: 124552 Jon3800
Social Spiders Spin Massive Nest
 
03:29
Social spiders can build nests more than 20 feet across. Please LIKE and SUBSCRIBE if you enjoyed! http://bit.ly/1Adl6ht **More info & videos below** A spider found in parts of the Caribbean and South America forms colonies that comprise thousands of individuals. Working together these colonies can build nests more than 20 feet across. "Animal Homes: Cities" premieres April 22, 2015 at 8/7c on PBS. Check your local listings. http://www.pbs.org/wnet/nature/animal-homes/11674/ --- For full NATURE episodes, check out http://www.pbs.org/wnet/nature/ Facebook: http://www.facebook.com/pbsnature/ Twitter: http://twitter.com/pbsnature/ Tumblr: http://pbsnature.tumblr.com/ Instagram: http://instagram.com/pbs_nature/ ----------------- Nature is a production of THIRTEEN for PBS. Throughout its history, Nature has brought the natural world to millions of viewers. The PBS series has been consistently among the most-watched primetime series on public television. ----------------- More videos: Sea otter orphan gets adopted: https://www.youtube.com/watch?v=qdy7DEhvsVU Owl silent flight: https://www.youtube.com/watch?v=6pWub12DUoU Bullfrog dad protects tadpoles: https://www.youtube.com/watch?v=l3uO2lO9JDk Gorilla mating games: https://www.youtube.com/watch?v=3431b8twU-U Snow Monkeys behind the scenes: https://www.youtube.com/watch?v=dDusYMTcyg4
Views: 33626 Nature on PBS
Tentsile tree tents: floating treehouses mimic spider webs
 
13:03
Treehouse architect Alex Shirley-Smith wanted to create a portable treehouse, a kind of ready-made, floating shelter that could be assembled in any backyard, wood or even city streets. In 2010 Shirley-Smith released several tree tent prototypes inspired by spiders' webs. "A spider always uses three anchoring points and the web finds its own position in space that's a circle in between any of those 3 points. So as long as you've got 3 anchoring points this tent will find its own central position to create its own shape inside that triangle. The whole thing is sort of taken from spider's web technology or you know, what exists in nature. Biomicmicry." After refining 11 prototypes, Shirley-Smith and partner Kirk Kirchev finally released a production model tree tent- the Tentsile Stingray. Using just 3 tree straps, 2 poles and one fly sheet, the Stingray will shelter up to 4 people in mid-air. It takes about 10 minutes to set-up and a few minutes to take down. And best of all, it is one size fits all. The tent can be used as a camping alternative- to keep you comfortably suspended above any animals, bugs or uncomfortable rocks-, but the design could also prove the basis for a new type of eco-village. Kirchev dreams of one day creating a community of (much larger) tensile structures where portable villages could be mounted and disassembled in a day, leaving little impact on the forest floor. Tentsile: http://www.tentsile.com/ Original story: http://faircompanies.com/videos/view/tentsile-tree-tents-floating-treehouses-mimic-spider-webs/
Views: 2422452 Kirsten Dirksen
𝐓𝐡𝐢𝐬 𝐏𝐮𝐩𝐩𝐲-𝐒𝐢𝐳𝐞𝐝 𝐒𝐩𝐢𝐝𝐞𝐫 𝐖𝐢𝐥𝐥 𝐇𝐚𝐮𝐧𝐭 𝐘𝐨𝐮𝐫 𝐃𝐫𝐞𝐚𝐦𝐬
 
01:05
𝐓𝐡𝐢𝐬 𝐏𝐮𝐩𝐩𝐲-𝐒𝐢𝐳𝐞𝐝 𝐒𝐩𝐢𝐝𝐞𝐫 𝐖𝐢𝐥𝐥 𝐇𝐚𝐮𝐧𝐭 𝐘𝐨𝐮𝐫 𝐃𝐫𝐞𝐚𝐦𝐬 According to the Guinness Book of World Records, the sector’s largest spider is the Goliath birdeater native to South America. These large spiders can weigh greater than 6 oz., with legs spanning as much as a foot. According to the Guinness Book of World Records, the arena’s largest spider is the Goliath birdeater. Native to South America, these massive spiders can weigh extra than 6 oz., with legs spanning up to a foot. Piotr Naskrecki, an entomologist and photographer at Harvard University's Museum of Comparative Zoology, studied the birdeater spiders, and compared them to the scale of a domestic dog. While a few specialists assume that the massive huntsman spider is bigger because of its wonderful leg span, the birdeater spiders are sincerely more big. They are named birdeaters due to the fact one changed into discovered ingesting a hummingbird, however their diet in particular consists of earthworms and different small animals they locate at the ground of their jungle habitat. Even though these spiders aren’t deadly to humans, they can nonetheless inflict some harm with their inch fangs. They also have microscopic barbs on their hair that after stuck on a predator, can cause pain, itchiness, and pain for days. Naskrecki is quoted as saying: "I've been running in the tropics in South America for lots, many years, and within the last 10 to fifteen years, I only ran across the spider three instances." He captured one woman specimen in Guyana, which changed into given to a museum after being studied. Subscribe & More Videos: https://goo.gl/hYyv4t Thank for watching, Please Like Share And SUBSCRIBE!!! #guinnesslargestspider, #worldnews
Views: 52 CRV
Jurassic Spider Eats Birds
 
03:42
This giant spider is not just known for eating birds. The massive golden silk orb-weaver spider spins a web that is considered magical! Rumpelstiltskin’s got nothing on the golden silk orb-weaver spider when it comes to spinning golden thread. This spider doesn't even need straw as a raw material. Among it’s many other amazing uses, it’s silk can even repair human nerve cells. They are more commonly known as banana spiders, not to be confused with the Brazilian wandering spider which is the world’s deadliest spider, these banana spiders live in the warmer areas of the Americas from North Carolina to Argentina. Their genus name nephila in Ancient Greek means “fond of spinning” but their origin is way older then Ancient Greek times. Nephila spiders are the oldest surviving spider genus in the world, dating back 165 million years to the middle Jurassic period, so maybe they’ll throw them in the next Jurassic Park Sequel. Now they may not be Jurassic sized like the giant huntsman spider, the largest spider in the world, but a 2 and ¾ inch banana spider was seen catching, killing, and eating an entire finch, and another one in Queensland Australia was seen killing and eating a foot and a half long brown tree snake. Golden orb-weavers have a venom with a neurotoxic effect similar to black widow spider but MUCH less powerful. If one bit YOU, the redness and swelling would be gone in about a day. People have described the bite as being much less severe than even a bee sting. Speaking of bees let’s talk about the AMAZING strength AND uses for the silk orb-weavers webbing. With the thickness of a human hair It has the strength to stop a bee flying 12.5 mph, almost twice the top speed of a house fly. It’s 6 x stronger than steel and even stronger then Kevlar, but possibly it’s best quality is that it’s very stretchy. These three qualities has lent too a WIDE variety of uses for the spider’s silk webbing. It’s been used to produce the cross hairs in microscope eyepieces, spun into violin strings in Japan, and even used to make an entire golden cape. Fisherman in the indo-pacific ocean ball it up and throw it into the water where it expands to become a net to catch bait fish, and natives in the South Pacific eat the pregnant females, raw or roasted, as a protein supplement. The most amazing potential use for the golden silk orb-weaver’s webbing is in the field of medicine. Research is being done involving the growth of nerve cells ON the web filaments, and then using those as nerve grafts. The beauty is that the immune system doesn’t recognize the silk so the body won’t attack or reject it. Now there’s a spider that can be called a productive member of society. World's Deadliest Spider http://youtu.be/pQYWBmk_V2g World's Largest Spider http://youtu.be/gths8z60j_w Videos (Creative Commons Attribution): -Materials in Motion: Super Elastic Plastic©Alli Dryer Vimeo Let's Connect -- http://www.epicadamwildlife.com/ -- http://www.facebook.com/epicadamwildlife -- http://www.twitter.com/epicwildlife -- http://gplus.to/epicwildlife
Views: 7095653 Epic Wildlife
Spiderman - just the webs
 
00:30
Spiderman is real a big dream of me ! it was always my dream to be the Spiderman and these days the VFX allows me to do it ! thank to the creater of After effects and Video Copilot for the Element 3D ! I did this in after effects with element 3D . Keys : Spiderman web shooting Spiderman 2017 Spiderman training session Peter parker laugh Peter parker training Spider webs peter parker glasses
Views: 1332 Jiho Park
Lucas the Spider - Encore
 
00:39
Lucas the Spider is the world’s most musical animal! But it takes a lot of hard work, dedication, practice and you have to dream big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 17255411 Lucas the Spider
SPIDER-MAN VR! | Spider-Man Homecoming VR Experience (HTC Vive)
 
13:11
I get to live out my childhood dream of becoming Spider-Man in Virtual Reality!!! Windlands ► https://www.youtube.com/watch?v=31gy7mF2ptM ►Twitter : https://twitter.com/Jack_Septic_Eye ►Instagram: http://instagram.com/jacksepticeye ►Facebook : https://facebook.com/officialjacksepticeye ►Merchandise: http://jacksepticeye.fanfiber.com/ Game Link ► http://store.steampowered.com/app/645480/SpiderMan_Homecoming__Virtual_Reality_Experience/ Edited by: https://www.youtube.com/user/pixlpit Outro animation created by Pixlpit: https://www.youtube.com/user/pixlpit Outro Song created by "Teknoaxe". It's called "I'm everywhere" and you can listen to it here http://www.youtube.com/watch?v=JPtNBwMIQ9Q
Views: 5249518 jacksepticeye
Barbie Halloween Costume Dress up Party - Disney Princess Kids - Royal High Show
 
11:31
Barbie House Halloween dress up party with Disney Princess kids. the hello dream house toy is decorated with spooky spider webs, jack o lanterns and halloween party decorations. We play pretend with dolls to create a fun kid friendly Halloween holiday party for kids. The dolls dress up in disney princess character costumes like Belle, Princess Jasmine, Moana, Snow White, Barbie Mermaid, Uma from Descendants and more. Titi Toys and Dolls Channel creates fun and entertaining videos on how to play with toys and dolls. Pretend play with Barbie, Chelsea, Anna, toddler Elsa, Anya, Elsia, Rapunzel American Girl Doll, Our Generation Dolls and baby dolls.
Views: 909109 Titi Toys and Dolls
Lucas the Spider - Naptime
 
00:39
Zzzz… Lucas the Spider is a very sleepy animal! I hope he finds a cozy spot to rest his big eyes. Sweet dreams! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 7246379 Lucas the Spider
Colt Spider - The Dream.
 
02:00
if u could like and comment
Views: 360 Spider
Luigi's Mansion Dark Moon - Gloomy Manor - A-5 Sticky Situation (Nintendo 3DS Gameplay Walkthrough)
 
24:06
Thanks for every Like and Favorite! They really help! This is Part 5 of the Luigi's Mansion Dark Moon Gameplay Walkthrough for the Nintendo 3DS! It includes A-5 Sticky Situation of the Gloomy Manor. I'm ZackScott! Subscribe if you have not! New videos every day! http://youtube.com/subscription_center?add_user=zackscottgames MORE GAMES: http://youtube.com/user/ZackScottGames/videos?flow=grid&view=1 BUY ZACKSCOTT SHIRTS: http://zackscott.spreadshirt.com SUBMIT LOL REPLAYS: http://j.mp/LOLReplaySubmit Thanks for watching my Luigi's Mansion Dark Moon Gameplay and Walkthrough on the 3DS! The Nintendo 3DS is awesome and Luigi's Mansion is too, so I'm excited to see how this game turns out! You may have seen the trailer or demo, but this playthrough will include everything! If you're a fan of Nintendo or the Luigi's Mansion series, then let's play Luigi's Mansion Dark Moon! Subscribe to ZackScottGames for new episodes of Luigi's Mansion Dark Moon today! SCARE UP SOME FUN Luigi returns in an all new puzzle-solving spooky adventure! Join Luigi as he stumbles and bumbles through haunted mansions, solving mind-melting puzzles and vacuuming up ghosts left and right with the help of Professor E. Gadd and an array of gadgets. Each mansion is filled with unique puzzles, a wide range of different ghosts, and a menacing boss battle. You'll need to use your head and the Poltergust 5000, a ghost-catching vacuum cleaner, to clean up the mansions and save the day. With so many new places to explore and all new ways to capture ghosts, Luigi's Mansion: Dark Moon is another star turn for Mario's heroic brother—and it's only on Nintendo 3DS. ZACKSCOTT CHANNELS http://youtube.com/ZackScott http://youtube.com/ZackScottFunClub http://youtube.com/ZackScottGames http://youtube.com/ZackScottPets FOLLOW ZACKSCOTT http://facebook.com/ZackScott http://instagram.com/ZackScott http://twitter.com/ZackScott http://ZackScott.tumblr.com LUIGI'S MANSION DARK MOON INFO Name: Luigi's Mansion: Dark Moon Developer: Next Level Games Publisher: Nintendo Platforms: Nintendo 3DS Release Date: March 24th, 2013
Views: 1443225 ZackScottGames
Why Don't Spiders Get Stuck In Their Webs? - Dinner Table Facts #41
 
02:47
Watch Taji tell you about spider webs. This video may contain any of the following songs: And So It Begins by Artificial.Music https://soundcloud.com/artificial-music Creative Commons — Attribution 3.0 Unported— CC BY 3.0 http://creativecommons.org/licenses/b... Music provided by Audio Library https://youtu.be/JpoEFiAJdxo Rock Angel by Joakim Karud https://soundcloud.com/joakimkarud Creative Commons — Attribution-ShareAlike 3.0 Unported— CC BY-SA 3.0 http://creativecommons.org/licenses/b... Music provided by Audio Library https://youtu.be/K8eRXvLL7Wo Dreams by Joakim Karud https://soundcloud.com/joakimkarud Creative Commons — Attribution-ShareAlike 3.0 Unported— CC BY-SA 3.0 http://creativecommons.org/licenses/b... Music provided by Audio Library https://youtu.be/VF9_dCo6JT4 Song: Joakim Karud - Flix & Chill (Vlog No Copyright Music) Music provided by Vlog No Copyright Music. Video Link: https://youtu.be/pSv9cYnn0Ao Joakim Karud: https://soundcloud.com/joakimkarud https://twitter.com/JoakimKarud https://www.theartistunion.com/joakim... Tobu - Colors [NCS Release] https://youtu.be/MEJCwccKWG0 http://www.7obu.com http://www.soundcloud.com/7obu http://www.facebook.com/tobuofficial http://www.twitter.com/tobuofficial http://www.youtube.com/tobuofficial Parasail - Silent Partner: https://youtu.be/MzO4zfNO0kQ Kubbi on Sound cloud: https://soundcloud.com/kubbi Kubbi on bandcamp: https://kubbi.bandcamp.com/music Kubbi on YouTube: https://www.youtube.com/user/KUBBIkthxbai/featured Kubbi / Up In My Jam (All Of A Sudden) Kubbi - Juggernaut Kubbi - Indolence(Renovation ) Kubbi - PewPewPew
Views: 62 Delta S
Spiders Swarm Australian Town
 
01:14
Spiders Take Over a Town in Australia - as part of the news and politics series by GeoBeats. Wagga Wagga is a beautiful and relaxed inland town in Australia. During recent floods, besides people, spiders had to find a way to cope with rising waters. And indeed they did - by moving to higher ground and covering a large area with spider webs. Fortunately, these are are harmless to people. In a 702 ABC Sydney report, Wagga resident Dennis Lane describes the scene as "it's all silver, it's like snow in the trees." and estimates there are millions of them. Similar situation was observed in Pakistan in 2011 when spiders moved to the trees during flooding. Interesting, the spiders were said to reduce the risk of malaria as they were trapping malaria causing mosquitos. This phenomenon is called ballooning in which spiders emanate their silk and get carried by the wind. Once the wind kicks in, they have no control and have been found hundreds of miles in water from sea shores. If they get caught in jet stream, they can be found miles above the ground where they can survive for days. Meanwhile, spiders at Wagga have plenty of food for now. If needed, they do eat their own webs or even other spiders.
Views: 184743 geobeats
Giant Webs and Blood-sucking Spiders on #SIYAYA | The Africa Channel
 
01:40
Come wild with us is a fast-paced adventure to fascinating places in and around South Africa’s national parks. In each fun-packed episode, you will see places and meet people that you would never even dream existed. ====== CHECK US OUT!!! - www.TheAfricaChannel.com Twitter/Instagram: @AfricaChannelTV facebook.com/theafricachanneltv
Views: 56 The Africa Channel

Refinement finite element analysis essay
Mit sloan optional essay word limit for uc
Common european values and identity essay papers
Descriptive essay format
Toy story essay