Home
Search results “Dreaming with spiders and webs”
Dream & Visions: Spiders & Webs
 
08:06
What do spiders mean in dreams? How about webs? * Based on the teachings of John Paul Jackson
Views: 61 Lynn Hardy
System Of A Down - Spiders
 
03:36
System of a Down's official music video for 'Spiders'. Click to listen to System of a Down on Spotify: http://smarturl.it/SystemSpotify?IQid=SystemSpiders As featured on System of a Down. Click to buy the track or album via iTunes: http://smarturl.it/SystemSOAD?IQid=SystemSpiders Google Play: http://smarturl.it/SpidersGPlay?IQid=SystemSpiders Amazon: http://smarturl.it/SOADAmazon?IQid=SystemSpiders More from System of a Down Chop Suey!: https://youtu.be/CSvFpBOe8eY Aerials: https://youtu.be/L-iepu3EtyE B.Y.O.B: https://youtu.be/zUzd9KyIDrM More great Alternative videos here: http://smarturl.it/Alternative00?IQid=SystemSpiders Follow System of a Down Website: http://www.systemofadown.com/ Facebook: https://www.facebook.com/systemofadown Twitter: https://twitter.com/systemofadown Instagram: https://instagram.com/systemofadown/ Subscribe to System of a Down on YouTube: http://smarturl.it/SYODSub?IQid=SystemSpiders --------- Lyrics: The piercing radiant moon, The storming of poor June, All the life running through her hair, Approaching guiding light, Our shallow years in fright, Dreams are made winding through my head, Through my head, Before you know, Awake, Your lives are open wide, The V-chip gives them sight, All the life running through her hair, The spiders all in tune, The evening of the moon, Dreams are made winding through my head, Through my head, Before you know, Awake
Views: 82205032 systemofadownVEVO
Spider Totem: Spirit Meaning of Spider
 
19:11
Do you identify with Spiders (or do they scare the pants off of you)? Has #Spider appeared to you lately in dreams or other ways? Spider may be your #totem animal, or perhaps it is a #poweranimal guide with a message for you. Listen in for insights into the #spiritanimal meaning of Spider. Check out my Spirit Animal Awareness oracle card deck here: https://www.etsy.com/listing/642491331/spirit-animal-awareness-oracle-card-deck?ref=shop_home_active_1 If you would like personal guidance in understanding your Spider dreams or experiences, you can book a reading with me here: https://spiritanimaloracle.as.me/schedule.php?appointmentType=category%3ASpirit+Animal+readings
Views: 11858 Art of Awakening
The Spider's Web: Britain's Second Empire (Documentary)
 
01:18:02
At the demise of empire, City of London financial interests created a web of secrecy jurisdictions that captured wealth from across the globe and hid it in a web of offshore islands. Today, up to half of global offshore wealth is hidden in British jurisdictions and Britain and its dependencies are the largest global players in the world of international finance. The Spider's Web was written, directed and produced by Michael Oswald, you can sponsor his future films on Liberapay (supports one time donations) and Patreon: https://liberapay.com/IndependentPOV https://www.patreon.com/independentdocumentary Share this documentary with your friends, and ask sites to feature it: https://twitter.com/spiderswebfilm https://www.facebook.com/Spiderswebfilm/ https://www.imdb.com/title/tt6483026/ The Spider's Web was substantially inspired by Nicholas Shaxson's book Treasure Islands you can read an extract of it here: https://www.theguardian.com/theguardian/2011/jan/08/jersey-tax-haven-nicholas-shaxson Translate this documentary here on youtube or contact us for the .srt file [email protected]dentpov.org For those interested to learn more about tax justice and financial secrecy, read about the Tax Justice Network's campaigning and regular blogs - become part of the movement for change and listen to the Tax Justice Network's monthly podcast/radio show the Taxcast https://www.taxjustice.net/taxcast/ Review on Filmotomy: https://filmotomy.com/the-spiders-web-britains-second-empire/ Review on Open Democracy: https://www.opendemocracy.net/en/opendemocracyuk/film-review-spider-s-web-britain-s-second-empire/ Website: www.spiderswebfilm.com German Version: https://youtu.be/1ZZR8vBKqwc Spanish Version: https://www.youtube.com/watch?v=85dsTnbhchc French Version: https://www.youtube.com/watch?v=hizj_6EH34M Italian Version: https://www.youtube.com/watch?v=VwmvXLamkto&t=1s Subtitles: French, Spanish, German, Italian, Russian, Arabic, Korean, Hungarian, English, Turkish, Portugese.
Views: 1877683 Independent POV
Social Spiders Spin Massive Nest
 
03:29
Social spiders can build nests more than 20 feet across. Please LIKE and SUBSCRIBE if you enjoyed! http://bit.ly/1Adl6ht **More info & videos below** A spider found in parts of the Caribbean and South America forms colonies that comprise thousands of individuals. Working together these colonies can build nests more than 20 feet across. "Animal Homes: Cities" premieres April 22, 2015 at 8/7c on PBS. Check your local listings. http://www.pbs.org/wnet/nature/animal-homes/11674/ --- For full NATURE episodes, check out http://www.pbs.org/wnet/nature/ Facebook: http://www.facebook.com/pbsnature/ Twitter: http://twitter.com/pbsnature/ Tumblr: http://pbsnature.tumblr.com/ Instagram: http://instagram.com/pbs_nature/ ----------------- Nature is a production of THIRTEEN for PBS. Throughout its history, Nature has brought the natural world to millions of viewers. The PBS series has been consistently among the most-watched primetime series on public television. ----------------- More videos: Sea otter orphan gets adopted: https://www.youtube.com/watch?v=qdy7DEhvsVU Owl silent flight: https://www.youtube.com/watch?v=6pWub12DUoU Bullfrog dad protects tadpoles: https://www.youtube.com/watch?v=l3uO2lO9JDk Gorilla mating games: https://www.youtube.com/watch?v=3431b8twU-U Snow Monkeys behind the scenes: https://www.youtube.com/watch?v=dDusYMTcyg4
Views: 38498 Nature on PBS
Thousands Of Spiders Built Massive Communal Webs In Texas
 
01:08
In the Dallas suburb of Rowlett, thousands of tiny spiders have covered a series of trees with webs in a communal food-catching effort that has some residents a bit freaked out. Typically, you'd see a spider working by itself to build a web.  However, on a football-field length of CA Roan Drive in Rowlett, Texas, thousands of spiders have come together to build a massive series of communal webs 40 feet into the trees.  The species of spider responsible for the community-oriented web construction is not yet known, but is likely to be a member of the Tetragnathidae family, who made similar shroud-like work in neighboring Lake Tawakoni State Park in 2007.  Mike Merchant, an urban entomologist from Texas A&M's AgriLife Extension Service, explained, “Arachnologists had previously noted that this species is known to build communal nests when conditions are right. But it is rare to see them building such large nests in the U.S. Spider experts have indicated that those ‘right conditions’ appear to include a glut of small insects like midges that emerge at night from lakes.”  And the insects from nearby Lake Ray Hubbard seem to fit the bill.  The spiders pose no harm to humans, and similar works of arachnid art have also been spotted in Sindh, Pakistan—where flooding, not food, forced some spiders into the trees as well.
Views: 188300 GeoBeats News
#34 Dreams About Spider Webs - Meaning & Interpretation
 
07:45
When you have this type of dream, this can be a sign that you will you have an important matter in your life that you have been unable to find an appropriate solution to, although you might have been able to wave it off quite a number of times, you are yet to find the right solution to these problems. Read more : https://alodreams.com/dreams-about-spider-webs.html
Spider as a Spirit Guide--What it Means When You Are Suddenly Seeing Spiders Everywhere
 
25:26
This video will teach you everything you ever wanted to know about what it means when Spider shows up as a spirit guide for you (You are suddenly getting spider-bites, seeing spiders everywhere, are feeling a new fear of or affection for spiders, people start sending you pictures and cards and gifts with spiders, etc.). You will learn how Spider can teach you how to create a happier life for yourself--especially with regard to money!, how to tackle challenges that feel too big to handle and how to deal with issues of feeling afraid and/or victimized. And if you're not sure if Spider is simply acting as your current spirit guide or is instead your personal totem, you can check out my video on the difference between totems and spirit guides, as well as my upcoming video, "Spider as a Totem" (Coming within the next two weeks, so stay posted!).
Views: 45035 Jordana Van
Spider Web Dream Catcher Tutorial
 
12:43
This nature inspired dream catcher is inexpensive and makes a really cute wall decorative. Things Required -Embroidery Hoop -Thread -Needle -A pair of scissors -Marker -Feathers -Tree Branches TIPS- -Preferably use a wooden hoop, if you get a plastic one make sure you paint it brown so that its not very conspicuous through the branches -Use a bigger needle -Though colorful feathers might solve the purpose, natural feathers would look the best -For marking equal segments on the hoop, you can fold a paper 4-5 times and use the creases as measurement *music credits* Song: Nova Artist: Ahrix Album: Nova Licensed to YouTube by RouteNote (on behalf of Ahrix); Routenote (Publishing), CMRRA, Abramus Digital, ASCAP, Broma 16, and 19 music rights societies Buy it now on Google Play
Views: 180247 All That Glitters
blink-182 - I Miss You (Official Video)
 
03:50
Music video by blink-182 performing I Miss You. (C) 2003 Geffen Records #Blink192 #IMissYou #Vevo
Views: 227710760 blink182VEVO
First Ever Video of Silkhenge Spider Birth
 
03:23
Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made? For any licensing requests please contact [email protected] Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below: Web tower-COI-5P GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATAAATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAATGAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCATAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAAATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT Link to the BLAST website where we aligned the piece of DNA https://blast.ncbi.nlm.nih.gov We found a total of 5 silkhenge structures and watched three spiders hatch from this. Filmed on an olloclip and Canon 70D. Subscribe to Aaron's channel on YouTube: https://www.youtube.com/channel/UCHr0u7Jsktou2CFl2GhTxYA Visit Yasuni Naitonal Park at http://www.Yasuni.ec Special thanks to Tropical Herping for guiding us through to Yasuni. Want to visit there? Check them out: http://tropicalherping.com/
Views: 1673665 The Jungle Diaries
How does a Spider make its web? | #aumsum
 
05:23
On its underside, a spider has organs called spinnerets that spin silk threads. First, it connects two end points like two branches with silk threads, forming a bridge. It then releases a loose thread. From its center, it adds a new thread, pulling it to form a Y shape. It joins the 3 points to form a frame. Then lays radial threads till the web becomes strong enough. Finally, from the center, it spins spirally completing the web.
Views: 137061 It's AumSum Time
Handling and rehousing my Orb-weaver Spider.
 
05:36
This is my Nephila (Golden silk orb-weaver). She's harmless which is why I'm not worried. Don't forget to SUBSCRIBE, it takes two seconds and really helps me out. Don't forget to hit that Like button if you enjoyed the video. Maybe check out some of my other videos? Check out this monster bug! https://www.youtube.com/watch?v=hzdjb2fMGbc Want to see the world's most beautiful spider? Also one of the rarest! https://youtu.be/CcpdPgea8Ko Handling the largest tarantula on YouTube! https://youtube.com/watch?v=jwJ8439M4CY&t=11s Thanks to those who Support me, I really appreciate it! My Patreon https://patreon.com/TarantulaDan My Paypal me paypal.me/TarantulaDan Let's Chat! My private Discord https://discord.gg/gDmDTrX Discord TarantulaAddicts https://discord.gg/NaxASer My Social Media Facebook https://facebook.com/TarantulaDan/ Twitter, Snapchat & Instagram @TarantulaDan My Merchandise page https://shop.skyou.com/collections/tarantuladans-merchandise http://redbubble.com/people/danieloakley Want to get some cool invertebrates and equipment? UK http://thespidershop.co.uk USA https://www.jamiestarantulas.com/ Europe http://www.spidersworld.eu/en/ Create content and want to get partnered? Look no further! https://fullscreenmedia.co/creators/?ref=tarantuladan I upload every Tuesday and Saturday and some Thursday's. Fancy a game? My XBONE and Nintendo Switch I.D is TarantulaDan MY PSN SulleyGSXR Thank you for your time, please take care of yourself and I'll see you in the next video.
Views: 6357017 TarantulaDan
Jurassic Spider Eats Birds
 
03:42
This giant spider is not just known for eating birds. The massive golden silk orb-weaver spider spins a web that is considered magical! Rumpelstiltskin’s got nothing on the golden silk orb-weaver spider when it comes to spinning golden thread. This spider doesn't even need straw as a raw material. Among it’s many other amazing uses, it’s silk can even repair human nerve cells. They are more commonly known as banana spiders, not to be confused with the Brazilian wandering spider which is the world’s deadliest spider, these banana spiders live in the warmer areas of the Americas from North Carolina to Argentina. Their genus name nephila in Ancient Greek means “fond of spinning” but their origin is way older then Ancient Greek times. Nephila spiders are the oldest surviving spider genus in the world, dating back 165 million years to the middle Jurassic period, so maybe they’ll throw them in the next Jurassic Park Sequel. Now they may not be Jurassic sized like the giant huntsman spider, the largest spider in the world, but a 2 and ¾ inch banana spider was seen catching, killing, and eating an entire finch, and another one in Queensland Australia was seen killing and eating a foot and a half long brown tree snake. Golden orb-weavers have a venom with a neurotoxic effect similar to black widow spider but MUCH less powerful. If one bit YOU, the redness and swelling would be gone in about a day. People have described the bite as being much less severe than even a bee sting. Speaking of bees let’s talk about the AMAZING strength AND uses for the silk orb-weavers webbing. With the thickness of a human hair It has the strength to stop a bee flying 12.5 mph, almost twice the top speed of a house fly. It’s 6 x stronger than steel and even stronger then Kevlar, but possibly it’s best quality is that it’s very stretchy. These three qualities has lent too a WIDE variety of uses for the spider’s silk webbing. It’s been used to produce the cross hairs in microscope eyepieces, spun into violin strings in Japan, and even used to make an entire golden cape. Fisherman in the indo-pacific ocean ball it up and throw it into the water where it expands to become a net to catch bait fish, and natives in the South Pacific eat the pregnant females, raw or roasted, as a protein supplement. The most amazing potential use for the golden silk orb-weaver’s webbing is in the field of medicine. Research is being done involving the growth of nerve cells ON the web filaments, and then using those as nerve grafts. The beauty is that the immune system doesn’t recognize the silk so the body won’t attack or reject it. Now there’s a spider that can be called a productive member of society. World's Deadliest Spider http://youtu.be/pQYWBmk_V2g World's Largest Spider http://youtu.be/gths8z60j_w Videos (Creative Commons Attribution): -Materials in Motion: Super Elastic Plastic©Alli Dryer Vimeo Let's Connect -- http://www.epicadamwildlife.com/ -- http://www.facebook.com/epicadamwildlife -- http://www.twitter.com/epicwildlife -- http://gplus.to/epicwildlife
Views: 7183028 Epic Wildlife
Don't Be Afraid of Spiders!
 
04:08
A SciShow Kids viewer wants to know more about spiders so she’s not afraid of them anymore. And know what? They’re not scary! They’re awesome! Special Thanks to The Missoula Insectarium for letting us film their beautiful Orb Weaver. Check them out! http://www.missoulabutterflyhouse.org/ ---------- Like SciShow? Want to help support us, and also get things to put on your walls, cover your torso and hold your liquids? Check out our awesome products over at DFTBA Records: http://dftba.com/SciShow Or help support us by becoming our patron on Patreon: https://www.patreon.com/scishow ---------- Looking for SciShow elsewhere on the internet? Facebook: http://www.facebook.com/scishow Twitter: http://www.twitter.com/scishow Tumblr: http://scishow.tumblr.com Instagram: http://instagram.com/thescishow SOURCES: http://www.biokids.umich.edu/critters/Araneidae/ http://www.caaspp.org/rsc/pdfs/activities/ELA_Spiders-and-Insects_CA.pdf http://www.explorit.org/science/spider.html
Views: 1510561 SciShow Kids
Lucas the Spider - Spinning Webs
 
00:45
Lucas the Spider isn’t just cute and funny animal, he’s smart too! He isn't about to let a little adversity keep him down. Anything is possible for this animal because he dreams big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 9029088 Lucas the Spider
This Puppy-Sized Spider Will Haunt Your Dreams
 
01:12
According to the Guinness Book of World Records, the world’s largest spider is the Goliath birdeater native to South America. These huge spiders can weigh more than 6 ounces, with legs spanning up to a foot. According to the Guinness Book of World Records, the world’s largest spider is the Goliath birdeater. Native to South America, these huge spiders can weigh more than 6 ounces, with legs spanning up to a foot. Piotr Naskrecki, an entomologist and photographer at Harvard University's Museum of Comparative Zoology, studied the birdeater spiders, and compared them to the size of a puppy. While some experts think that the giant huntsman spider is larger because of its impressive leg span, the birdeater spiders are actually more massive. They are named birdeaters because one was observed eating a hummingbird, but their diet mainly consists of earthworms and other small animals they find on the ground in their jungle habitat. Even though these spiders aren’t deadly to humans, they can still inflict some damage with their two inch fangs. They also have microscopic barbs on their hair that when stuck on a predator, can cause pain, itchiness, and discomfort for days. Naskrecki is quoted as saying: "I've been working in the tropics in South America for many, many years, and in the last 10 to 15 years, I only ran across the spider three times." He captured one female specimen in Guyana, which was given to a museum after being studied.
Views: 3227535 GeoBeats News
System of a Down - Spiders Lyrics
 
03:37
https://soundcloud.com/g-karal
Views: 3847964 C.arlos
"Dreaming" - Webs (Sabre Ronzh's Ep.)
 
01:38
Thanks for watching, ops in comments? LIKE, SHARE, SUBSCRIBE!!!
Views: 89 Webs VFX
How To Make A BLACK COBWEB CAKE! Chocolate Cake, Black  Ganache and filled with Halloween Candy!
 
12:45
I'm Yolanda and this is HOW TO CAKE IT! CLICK BELOW FOR ALL INGREDIENTS AND RECIPES! New videos every Tuesday! SUBSCRIBE: http://bit.ly/HowToCakeItYT Like my shirt? Buy all my Cake Tees HERE: http://bit.ly/HowToCakeItTees Hi, I'm Yolanda! Some people call me the Beyoncé of cakes. I post my drool-worthy, jaw-dropping caking creations every Tuesday at 11am EST! From novelty cakes that look like your favourite foods to my MEGA mash up cakes that have layers upon layers of goodness - I dream in cake! Got an idea for a cake? I'd love to hear it - subscribe & comment below! FOLLOW ME: Facebook - https://www.facebook.com/HowToCakeItWithYolanda Twitter - https://twitter.com/yolanda_gampp Instagram - http://instagram.com/yolanda_gampp Pinterest - https://www.pinterest.com/yolanda_gampp Snapchat - @yolanda_gampp USEFUL LINKS: For FULL DETAILS on how I made this BLACK COBWEB SCAREDY CAKE including INGREDIENTS AND TOOLS head over to my blog - http://bit.ly/HalloweenCobwebCakeRecipe Get my SIMPLE SYRUP SQUEEZE BOTTLE! - http://bit.ly/SimpleSyrupSqueezeBottle WATCH my BUTTERCREAM TUTORIAL! - http://bit.ly/YOsButtercream WATCH my CHOCOLATE CAKE TUTORIAL - http://bit.ly/YoYosChocolateCake WATCH my LEVELLING CAKES TUTORIAL - http://bit.ly/LevelAndLayer Get your VERY OWN CAKE TEE HERE! - http://bit.ly/HowToCakeItTees What is that liquid I drizzle all over my cakes?? SIMPLE SYRUP! GET my RECIPE - http://bit.ly/YOsSimpleSyrupRecipe THE HOW TO CAKE IT TEAM Director of Photography: Chet Tilokani http://www.chet4days.com Editor: Orhan Sumen https://vimeo.com/orhansumen Producers: Jocelyn Mercer & Connie Contardi http://www.cjmercon.com T-Shirt: http://www.howtocakeit.com/
Views: 3270739 How To Cake It
Hauntingly huge spider spotted in Australia
 
00:40
A woman in Australia got quite a fright when she saw a giant spider on her home on July 23.
Views: 183788 ABC News
No Doubt - Spiderwebs
 
04:04
Best of No Doubt: https://goo.gl/arujs7 Subscribe here: https://goo.gl/HRNLKB Music video by No Doubt performing Spiderwebs. (C) 2003 Interscope Records
Views: 17859174 NoDoubtVEVO
A Plague Of Spiders Has Completely Covered An Australian Town In Webs
 
02:05
Imagine waking up to a beautiful snow blanketed field outside of your picturesque farm. But wait… it’s still summer so obviously that couldn’t be snow. You walk outside your front door to take a closer look and immediately your skeleton jumps out of your skin from the most disturbing sight you’ve ever seen! Spiders! Millions and millions of creepy crawly spiders! That’s exactly what happened in a small town in Australia called Wagga Wagga. Recent floods have covered miles and miles of once lush green land with feet of muddy water. This caused the evacuation of over 13,000 people. Well, naturally spiders aren’t the biggest fans of detrimental water levels either so they took to the hills. Millions of spiders had to migrate to higher ground to escape the flooding. This caused an extreme population of the evil little creatures to congregate in one small area. Take a look at these horrifying images that are causing nightmares around the world. This is why you want to stay far away from Australia. -~-~~-~~~-~~-~- Please watch: "This Navy Man Reunited With His Son After Weeks Away Then He Discovered His Wife Had Been Lying1" https://www.youtube.com/watch?v=J7dER2ocfTk -~-~~-~~~-~~-~-
Views: 1123 Behind The World
April 3 dreams: spider & webs, steve jobs, internet trolls, lassie
 
26:22
00:47 idea of Eureka Marina restaurant linked to arched doorways 05:12 A spider with web keeps crawling on my hand. Word: mouse. 08:43 spiders & webs are symbolic of a system of corruption that extends across all systems 10:53 Tobi Vail has a band called Spider and the Webs 12:37 video with Kurt Cobain; words/dialogue "'snowmen' hate the punk culture'" 13:02 attacked by chipmunk, appears to be trapped in the apartment, hope it doesn't have rabies, think about asking parents (mom, dad) for help 14:24 "Steve Jobs of cannabis" article is about someone named Joshua Haupt. The story was all over national media on April 1; I can no longer find the version of the story which included an image of Steve Jobs holding a tangerine iBook. 15:04 I think this dream is less about Steve Jobs and more about paying people to create disruption and disinformation ("jobs") online. And it suggests to me that the name "Steve" is significant. I believe this could be a reference to Mudhoney guitarist Steve Turner. I haven't spoken much about Turner but there is circumstantial evidence he is involved in these kinds of activities. 21:25 Someone is in fact regularly hiring internet trolls, but they can hire more than internet trolls - they can "work something out" with your personal counselor, your doctor, with police officers, with your teacher, and anyone in any system of power. They can, and they do. And it's been done so much that people seem to accept it and don't realize how deeply damaging it is to corrupt our systems in this way. 23:56 People create fake realities, fake crimes, fake experience, etc, all to hide what they're doing to me. 24:11 Characters like Jackie & Donna from That 70s show working together with Lassie. 24:27 Lassie (the television dog) behaves like a mind-controlled animal. 25:26 "Lassie" may be a more general link to the idea of a "dog" which is someone who assists someone else. Police, doctors, etc are sometimes called "dogs," especially when they are charged with protecting someone linked to this game. These so-called "dogs" often protect people who are engaged in criminal behaviors related to this Game, and fail to protect, or further victimize, the victims of these crimes.
Views: 8 Erika Meyer
Walking into spider webs
 
01:54
Compilation video of people's reactions to walking into spider webs.
Views: 14266 Article Cats
BREAKING SPIRITUAL SPIDER WEBS - EAGLE PROPHET
 
25:24
#eagleprophet #ghanacelebrities
Views: 899 Rtv Ghana
SPIDER WEBS!!! Super powerful!
 
06:04
Heres a quick witchy tidbit on spider webs and their uses. We are collecting some we have been letting grow for a bit and will be using them soon! Do throw yours out! Keep them! They can kick some serious ass for you!
Views: 317 Hex Arcanum
What are Spider-Mans Webs actually made of?
 
01:57
In honor of the new Spiderman video game, here's a Spiderman video Download the RIZE app https://join.rizeapp.io/hampton Subscribe fam http://bit.ly/SubHampton Twitter: https://twitter.com/hampton Instagram: https://www.instagram.com/hampton_/ Facebook: https://www.facebook.com/HamptonFunny/ Snapchat: https://www.snapchat.com/add/Miles_Hampton What are Spider-Mans Webs actually made of? Hampton https://www.youtube.com/TheHamptonChannel
Views: 59158 Hampton
Coldplay - Trouble
 
04:53
Get A Head Full Of Dreams now: – iTunes http://cldp.ly/cpitunes – Amazon http://smarturl.it/AHFODamazon – Google Play http://smarturl.it/AHFODgplay – CD (with exclusive holographic stickers) http://smarturl.it/AHFODcd – Vinyl (with exclusive holographic stickers) http://smarturl.it/AHFODvinyl ~ Follow Coldplay ~ Website: http://www.coldplay.com Twitter: https://twitter.com/coldplay Facebook: https://www.facebook.com/coldplay Instagram: http://instagram.com/coldplay Google+: http://instagram.com/coldplay Tumblr: http://coldplay.tumblr.com/ VK: https://vk.com/coldplay
Views: 109393590 Coldplay
Bug Spray Kills Spider, Spawns Nightmare
 
01:41
#Outrageous_Acts Wednesdays 9/8c on Science Channel When Australian Brent Askwith gave this spider the bug spray treatment, nature inflicted her cold revenge by birthing nightmares all over his floor. http://www.sciencechannel.com/tv-shows/outrageous-acts-of-science/ Full episodes streaming FREE on Science GO: https://www.sciencechannelgo.com/outrageous-acts-of-science/ Check out Brent Askwith's YouTube channel: https://www.youtube.com/user/baskwith Subscribe to Science Channel: http://www.youtube.com/subscription_center?add_user=sciencechannel Check out SCI2 for infinitely awesome science videos. Every day. http://bit.ly/SCI2YT
Views: 20315702 Science Channel
Play-by-Play #1: Spider-Man (PS1) - Pt 1 - Just Spinning Webs
 
15:03
Joe and Oliver play Spider-Man for the PlayStation! Subscribe for more film and video game fun: https://bit.ly/2GEsLQy Follow Dream Sequence on Twitter: https://twitter.com/MediaSequence Follow Dream Sequence on Facebook: https://www.facebook.com/MediaDreamSe...
Views: 43 Dream Sequence
About Dream Webs & Bulk orders
 
05:04
Hello, my name is Kelsie Young and I am a co-owner and the artisan of Dream Webs. I personally create traditional, one of a kind dream catchers that are inspired by nature. [email protected]
Views: 15 Kelsie Young
Luigi's Mansion Dark Moon - Gloomy Manor - A-5 Sticky Situation (Nintendo 3DS Gameplay Walkthrough)
 
24:06
Thanks for every Like and Favorite! They really help! This is Part 5 of the Luigi's Mansion Dark Moon Gameplay Walkthrough for the Nintendo 3DS! It includes A-5 Sticky Situation of the Gloomy Manor. I'm ZackScott! Subscribe if you have not! New videos every day! http://youtube.com/subscription_center?add_user=zackscottgames MORE GAMES: http://youtube.com/user/ZackScottGames/videos?flow=grid&view=1 BUY ZACKSCOTT SHIRTS: http://zackscott.spreadshirt.com SUBMIT LOL REPLAYS: http://j.mp/LOLReplaySubmit Thanks for watching my Luigi's Mansion Dark Moon Gameplay and Walkthrough on the 3DS! The Nintendo 3DS is awesome and Luigi's Mansion is too, so I'm excited to see how this game turns out! You may have seen the trailer or demo, but this playthrough will include everything! If you're a fan of Nintendo or the Luigi's Mansion series, then let's play Luigi's Mansion Dark Moon! Subscribe to ZackScottGames for new episodes of Luigi's Mansion Dark Moon today! SCARE UP SOME FUN Luigi returns in an all new puzzle-solving spooky adventure! Join Luigi as he stumbles and bumbles through haunted mansions, solving mind-melting puzzles and vacuuming up ghosts left and right with the help of Professor E. Gadd and an array of gadgets. Each mansion is filled with unique puzzles, a wide range of different ghosts, and a menacing boss battle. You'll need to use your head and the Poltergust 5000, a ghost-catching vacuum cleaner, to clean up the mansions and save the day. With so many new places to explore and all new ways to capture ghosts, Luigi's Mansion: Dark Moon is another star turn for Mario's heroic brother—and it's only on Nintendo 3DS. ZACKSCOTT CHANNELS http://youtube.com/ZackScott http://youtube.com/ZackScottFunClub http://youtube.com/ZackScottGames http://youtube.com/ZackScottPets FOLLOW ZACKSCOTT http://facebook.com/ZackScott http://instagram.com/ZackScott http://twitter.com/ZackScott http://ZackScott.tumblr.com LUIGI'S MANSION DARK MOON INFO Name: Luigi's Mansion: Dark Moon Developer: Next Level Games Publisher: Nintendo Platforms: Nintendo 3DS Release Date: March 24th, 2013
Views: 1497330 ZackScottGames
How to make a SUN dreamcatcher - DIY Tutorial
 
06:46
Easy tutorial on how to make a colorful spiral SUN dreamcatcher. For additional info to this tutorial, visit: http://colorful-crafts.com/how-to-make-a-sun-dreamcatcher-spiral-series/ Check out Part 1 in the spiral dreamcatcher series: https://www.youtube.com/watch?v=TKeItxW1JFk Music by: Carefree Kevin MacLeod (incompetech.com) Licensed under Creative Commons: By Attribution 3.0 License http://creativecommons.org/licenses/by/3.0/
Views: 130146 colorful crafts
Lucas the Spider - Captured
 
00:31
Oh no, Lucas the Spider may or may not know that he is in danger! What will happen? This spider will have to dream big to get out of this one! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 20629506 Lucas the Spider
3D Dreamcatcher Interlocking Webs Tutorial
 
01:55:50
Advanced level project - How to make an interlocking, 3-dimensional dreamcatcher! Check out my Macrame/Friendship Bracelet Playlist here: https://www.youtube.com/playlist?list=PLH4Ne_h5fOZfDeAGUj_BfD2a47aY3jYqm
Views: 40429 Art and Such
Make A Spider Web Maker Gun | Hot Glue Gun Web Shooter (DIY) Cobweb Spinner
 
06:46
For the most realistic fake spider webs make a DIY cobwebbing webcaster hot glue gun web shooter for halloween or stage scenes. Need spooky cobwebs for Halloween make a hot glue gun into a hot glue web gun or webcaster. How to make a realistic looking spider web cobweb shooter. We share how we made our DIY cobweb gun. It's easy to make and convert a regular hot glue stick gun into a spider web making cobweb spinning easy to use gun. No extreme holiday yard haunter decorator should be without one of these web casters. There are several great web guns on the market to buy but if your like us and have fun making your own stuff then this video may help give you some ideas. Just follow along with these easy to follow steps like drilling holes and assembling plumbing parts from an ice maker kit and quick connect to air hoses and then hooking to an air supply or small air compressor and you can create movie set quality creepy cob webs. We also show you how we use the web guns and our techniques. Watch these realistic spider webs form on our Old Western Mining Ghost Town we made for Halloween. For more prop making videos check out our YouTube Channel http://www.youtube.com/user/HollywoodHaunter Visit our Facebook Page https://www.facebook.com/HollywoodHaunter If you found this video helpful or entertaining please give us a thumbs up and be sure to subscribe to our channel. Thank you so much for watching our video and supporting our channel. Danosongs.com coppermountain Incompetech.com Delay Rock http://www.hollywoodhaunter.com/ http://youtu.be/51lSU0Odkn4 #halloween #halloweendecorations #hollywoodhaunter
Views: 90832 Hollywood Haunter
Lucas The Spider - One Man Band
 
00:58
What animal do you know can play multiple instruments? Lucas the Spider, that’s who! Anything is possible if you dream big! Do you love Lucas the Spider? Check out our new online store for some cute animal merchandise! https://teespring.com/stores/lucas-the-spider-shop © 2018 Fresh Interactive Inc. All Rights Reserved.
Views: 7279669 Lucas the Spider
Barbie House Halloween Decorations & Doll Costumes with Chelsea Ken Skipper & Stacie
 
10:07
Barbie decorates her Dream doll house with fun spooky halloween decorations. Skipper and Chelsea help her put up party accessories like pumpkins, spider webs, trick or treat candy and halloween lights. Barbie Dream house can have many parties for christmas, birthdays or any other holiday. Join us to see how barbie and her sisters dress up for halloween in their favorite costumes. Chelsea is a fairy princess, Barbie dresses up as a witch, Ken as wolverine and Skipper as Miraculous Ladybug. This video is a very kid friendly and family oriented video and shows family values such as sharing, roleplaying and helping out with party planning. This Halloween video is very funny, full of energy and appropriate for all ages. You can see more Kid friendly and Family Barbie videos on my channel featuring your favorite characters such as Barbie , Ken, Chelsea, Frozen Elsa Toddlers , Princess Anna, Disney Princesses, Moana, Lol Surprise dolls and American Girl dolls.
Views: 408699 Titi Toys and Dolls
Unboxing my Dream Tarantulas
 
12:58
Isaiah and I unpack our dream tarantulas. We're all very excited and Happy. Stay tuned for a P.vittata rehouse as I found the perfect cage. Thanks Paul for the package, you're the best
Views: 128142 Jon3800
Astonishing of Spider webs pretty. " Spider web"
 
01:46
Hope you like our compilation, please share it and SUBSCRIBE! Watch also our other videos! youtube Subscribe to this ►► https://goo.gl/93XuWY ✔️ THANK YOU ✔️ Astonishing of Spider webs pretty. It’s fascinating to watch spiders spin their webs. What makes a particular spider create one design, while another will come up with something totally different? They truly are works of art, which catch flies as a bonus. Spider web. #SpideWebs #Spide #ArchimedesChannel
Views: 702 Archimedes Channel
Le Butcherettes - spider/WAVES (Official Music Video)
 
04:16
Purchase, download & stream "bi/MENTAL" here: https://RiseRecords.lnk.to/biMENTAL Injuries are slashed deep open, messiahs hold them still Heatwaves calling for a thunder strike You’ve tied us up, slowly lost the light Losing five pesos on a day of work hard For once, come closer Listen to my cry You’re a liar You can’t erase my fight from prophecies No apologies are wanted Razors cut your grace Injuries are slashed deep open, messiahs hold them still In, you want in, in, you want in, in, you want in Slave gold mercy isn’t here to stay Patience leaves me when I see your way Confusion arises as I try to latch on I was Mother Mary smothered by her God Lies, they’re all lies! Your feathers are falling while you fly Why can’t I feel anything when you say goodbye? Injuries are slashed deep open, messiahs hold them still In, you want in, in, you want in, in, you want in Injuries are slashed deep open, messiahs hold them still Director: NOUN
Views: 81707 riserecords
Advanced Lucid Dream Techniques -- Spiderman Sticky Webs
 
01:51
Description of a lucid dream technique I use to shoot webs from my hands and swing from them. I usually use this to get to high places or to just have fun!
Views: 1080 Jonah Haas
Buying A Real Dark Web Mystery Box Goes Horribly Wrong!!! Very Scary!
 
29:02
So Today I finally received the package I ordered about a week ago from the Dark Web. I wanted to know if this new hype was real. I see so many people making videos about these mystery boxes that can be found on the deep web so I decided to investigate a little further for my self. After buying a mystery box for $300 from an anonymous seller using bitcoin on the dark web, I was surprised to find that the package arrived at my PO Box Today. You will never believe the scary and creepy things that came inside this box. I am literally beside myself after making this video. I have felt very uneasy the last few days. I hope you guys enjoy this video and take my word. Never go on the Dark Web. It's not a good place! Follow Bre on Instagram @ Freebrenasty If you are thinking of making youtube videos or just recording videos similar to the ones that I am making you will find a list of all the equipment I am using down below: Camera : https://amzn.to/2L8w4Bg (MAJOR DISCOUNT!) Lens : http://geni.us/K4cAZ (amazon) Studio Lighting Kit : http://geni.us/NP66ynx (amazon) iRig Mic to DSLR adapter: http://geni.us/BqxL (amazon) Microphone : http://geni.us/jGAFNw (amazon) Led Lighting : http://geni.us/evVb (amazon) Thank you guys for watching and being part of my dream! The channel is alive and better than ever! I hope this video helped in deciding if this is the one for you! All background music was used from the youtube audio library and is royalty free. Also I have recently become a participant in the Amazon Associates Programs, affiliate advertising programs designed to provide a means to earn fees by linking to amazon.com in order to help the channel Grow! Let's make 2018 kick @ss! Email me: [email protected] Follow me on Facebook: http://www.facebook.com/mindseedtv
Views: 14455366 Mind Seed TV
Undertale Remixed - Spider Dance (Holder Remix) Muffet Theme - GameChops
 
03:01
Download ► http://smarturl.it/SpiderDanceHolder Undertale Remixed is the first GameChops remix album by Holder, his first full-length album, a remix tribute to hit indie game Undertale, remixing 12 themes in 10 different genres. ▾ DOWNLOAD HOLDER - UNDERTALE REMIXED ▾ ► http://smarturl.it/SpiderDanceHolder Album Playlist ► https://www.youtube.com/playlist?list=PLBsm_SagFMmezcMxH9QRHlxoT63yAFtl3 Artwork by Palidoozy ► http://palidoozy-art.tumblr.com/post/131788714521/heres-a-small-compilation-post-of-all-the Video by Cutman ► http://youtube.com/c/CutmanPlays ▾ Follow Holder ▾ ► http://youtube.com/StrangeHolder ► http://soundcloud.com/MajorLeagueWobs ► http://facebook.com/MajorLeagueWobs ► http://twitter.com/MajorLeagueWobs ▾ Follow GameChops ▾ ► http://soundcloud.com/GameChops ► http://facebook.com/GameChops ► http://twitter.com/GameChops ► http://instagram.com/VideoGameDJ ▾ GAMECHOPS on SPOTIFY ▾ ► http://bit.ly/gamechopsspotify ▾ SUBSCRIBE on YOUTUBE ▾ ► http://bit.ly/gcsub ▾ MUSIC PLAYLISTS ▾ ► Undertale ▷ https://www.youtube.com/playlist?list=PLBsm_SagFMmex34KnjrxZHDpzboJ8kenh ► Smooth McGroove Remixed ▷ https://www.youtube.com/playlist?list=PLBsm_SagFMmfTMwTgTReGBq2I8JrHLtMt ► Singles ▷ http://youtu.be/2zQHEqvLiWE?list=PLBsm_SagFMmenBSAAPhHpl5TO2qHF_arK ► Splatoon Remixes ▷ https://youtu.be/EcCBvFS-g4s?list=PLBsm_SagFMme1rV0t-p-F4gbjmR6G7UJ4 ► Katamari Remixes ▷ https://www.youtube.com/watch?v=yKwBQwuyLi4&list=PLBsm_SagFMmen71zNsiPCbv2bW3ia-sQg ► Castlevania Remixes ▷ https://www.youtube.com/watch?v=mnyC2qEHGHU&list=PLBsm_SagFMmdEkCYdE1-BAIo20dwsQDhG ► Metroid Remixes ▷ https://www.youtube.com/watch?v=DfSVlcsLXW4&list=PLBsm_SagFMmeW5JuUNgvcM7FQ2GN2Gs9l ► Pokémon Remixes ▷ https://www.youtube.com/watch?v=aOD3KoNQuLY&list=PLBsm_SagFMmfbf7qkhwQF7WhDEElsg2OY ► OutRun Remixes ▷ https://www.youtube.com/watch?v=ZgxSnHfQ-JU&list=PLBsm_SagFMmegDeO_bQBlUjd9LxUgDagK ► Bravely Default Remixes ▷ https://www.youtube.com/watch?v=jBO07j8Unqc&list=PLBsm_SagFMmfnBE14TZmJPQ1Uqw7mJ5II&index=2 ► Year of the Yoshi ▷ https://www.youtube.com/watch?v=BjOZy_1vObU&list=PLBsm_SagFMmfQYmqzi4cVGp2OasqQFz7F ► Mega Man Remixes ▷ https://www.youtube.com/watch?v=_lVyPLaSQwc&list=PLBsm_SagFMmfL0cgV_XRvmPDAFoEHfMtM ► Animal Crossing Remixes ▷ https://www.youtube.com/watch?v=-HWFyfgif24&list=PLBsm_SagFMmcW07tHgrU2uZTXsz735lu9 ► Sonic the Hedgehog Remixes ▷ https://www.youtube.com/watch?v=SOUmRP9TlCw&list=PLBsm_SagFMmclehwDH9XGe9ZdvMcSkMft ► Super Mario RPG Remixes ▷ https://www.youtube.com/watch?v=9DNUp9EzwXQ&list=PLBsm_SagFMmdIgyLCTSywjM2OHimvw0ME ► Ridge Racer Remixes ▷ https://www.youtube.com/watch?v=6qtkTD89m44&list=PLBsm_SagFMmfkQzVFnRzatjIML3mPbf4R ► Tales of Symphonia Remixes ▷ https://www.youtube.com/watch?v=MQJInTkk98c&index=1&list=PLBsm_SagFMmfPjFqc9Hs9QbUWWTrkOCUJ ► Zelda: Link’s Awakening Remixes ▷ https://www.youtube.com/watch?v=RpvEBiqwJ4w&list=PLBsm_SagFMmcp6Tq45iiY2eHjc1bTWIc5 ► Final Fantasy Remixes ▷ https://www.youtube.com/watch?v=gGU1i3X3d-w&list=PLBsm_SagFMmfEhLLeuG4lTxTGuzFhUWZ2 ► Legend of Zelda Remixes ▷ https://www.youtube.com/watch?v=ljrbDllfdHc&list=PLBsm_SagFMmdmIwN8yRuaHSlwTD8b8SRC ► NESteryears ▷ https://www.youtube.com/watch?v=aAEG1CW4NWE&list=PLBsm_SagFMmfxhCWWr-2nFVIgOVWdAQa4 ► Wii U Grooves ▷ https://www.youtube.com/watch?v=HruB9ZYaeL8&list=PLBsm_SagFMmcHLfxttxFMpIOJwKnJhMe6 ▾ ABOUT GAMECHOPS ▾ GameChops is a record label for video game music, founded by Dj CUTMAN. We're a video game remix label focus on high quality production and mastering. Many of us are DJs and performers,so GameChops music is mixed for enjoyment in both headphones and live shows. We love video game themes and game music! Many of our remix albums have had the video game compositions mechanically licensed by our friends at Loudr.fm. Because of this, we can offer GameChops music with a Creative Commons license that permits commercial use. This means you are free to use any GameChops music you buy through Loudr or other stores in your videos or other content. You can support GameChops by buying some music and subscribing to our channel. Visit http://GameChops.com for more information and full discography ▾ FOLLOW GAMECHOPS ▾ http://www.gamechops.com http://youtube.com/GameChops http://soundcloud.com/GameChops http://twitter.com/GameChops http://facebook.com/GameChops http://www.gamechops.com
Views: 11082017 GameChops
Exhibits:  The Webs We Weave - Spider Pavilion 2011
 
03:54
The Webs We Weave Check out this short film with interviews of Lila Higgins and Sam Easterson, the folks behind the Spider Pavilion! http://www.nhm.org/spiders http://www.nhm.org/naturalist Music by: "Revolve" by hisboyelroy http://ccmixter.org/files/hisboyelroy/430 is licensed under a Creative Commons license: http://creativecommons.org/licenses/nc-sampling+/1.0/
Tentsile tree tents: floating treehouses mimic spider webs
 
13:03
Treehouse architect Alex Shirley-Smith wanted to create a portable treehouse, a kind of ready-made, floating shelter that could be assembled in any backyard, wood or even city streets. In 2010 Shirley-Smith released several tree tent prototypes inspired by spiders' webs. "A spider always uses three anchoring points and the web finds its own position in space that's a circle in between any of those 3 points. So as long as you've got 3 anchoring points this tent will find its own central position to create its own shape inside that triangle. The whole thing is sort of taken from spider's web technology or you know, what exists in nature. Biomicmicry." After refining 11 prototypes, Shirley-Smith and partner Kirk Kirchev finally released a production model tree tent- the Tentsile Stingray. Using just 3 tree straps, 2 poles and one fly sheet, the Stingray will shelter up to 4 people in mid-air. It takes about 10 minutes to set-up and a few minutes to take down. And best of all, it is one size fits all. The tent can be used as a camping alternative- to keep you comfortably suspended above any animals, bugs or uncomfortable rocks-, but the design could also prove the basis for a new type of eco-village. Kirchev dreams of one day creating a community of (much larger) tensile structures where portable villages could be mounted and disassembled in a day, leaving little impact on the forest floor. Tentsile: http://www.tentsile.com/ Original story: http://faircompanies.com/videos/view/tentsile-tree-tents-floating-treehouses-mimic-spider-webs/
Views: 2548107 Kirsten Dirksen
Mod Melt Glow Spider Webs
 
01:05
Join hosts Cathie Filian and Steve Piacenza as they show you how to make fun spiderwebs with Mod Melts and Glow-In-The-Dark Mod Podge for your Halloween projects. Subscribe for more fun and informative Plaid videos! → https://www.youtube.com/c/plaidcrafts?sub_confirmation=1 ▷ Check out these other videos……. 👑 Related Video ► https://youtu.be/JYi9peuBAPU 💑 Related Video ► https://youtu.be/_tii91aRfvQ 👹 Related Video ► https://youtu.be/jKDh4-y2lq4 ▷ FOLLOW US FOR MORE CRAFTINESS!! BLOG ‣https://plaidonline.com/blog TWITTER ‣https://twitter.com/plaidcrafts INSTAGRAM ‣https://www.instagram.com/plaidcrafts/ FACEBOOK ‣https://www.facebook.com/InspiredByPlaid Plaid’s channel offers inspiration and ideas for creative living. Use our trusted techniques and how-to’s, crafts, entertaining, holiday projects and more to add a dash of DIY to your life!
Views: 3120 Plaid Crafts